Transcript asmbl_70073

Sequence
Transcript Sequence for observation asmbl_70073 of TGE0002528:
CCGGCGTGGGCGGTGCCACCCCTCCCCCCGGCGGCCCCGCGCGCAGCTCCCGGCTCCCTCCCCCTTCGGATGTGGCTTGAGCTGTAGGCGCGGAGGGCCGGAGACGCTGCAGACCCGCGACCCGGAGCAGCTCGGAGGCGGTGAATAATAGCTCTTCAAGTCTGCAATAAAAAATGGCCTCCAACAAAACTACATTGCAAAAAATGGGAAAAAAACAGAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTCGTGGAAAAAGTACTAGATCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTGAAGTGGAAGGGATTTACAGATGCTGACAATACTTGGGAACCTGAAGAAAATTTAGATTGTCCAGAATTGATTGAAGCGTTTCTTAACTCTCAGAAAGCTGGCAAAGAAAAAGATGGTACAAAAAGAAAATCTTTATCTGACAGTGAATCTGATGACAGCAAATCAAAGAAGAAAAGAGATGCTGCTGACAAACCAAGAGGATTTGCCAGAGGTCTTGATCCTGAAAGAATAATTGGTGCCACAGACAGCAGTGGAGAATTGATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCAGACTTGGTGCTGGCGAAAGAGGCAAATATGAAGTGTCCTCAAATTGTAATTGCTTTTTATGAAGAGAGACTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAATTGTTCACATTGTTCTTTTATATATATTTATATATATATATAAAAATTGGGTCTTAGATTTTGATTTACTAGTGTGACAAAATAACTACATCCTAATGAAAATCAAGTTTGATATGTTTGTTTTGAAAGTAGCGTTGGAAGAGTTGTTGGGGGTTTTTTGCATCCATAGCACTGGTTACTTTGAACAAATAAATAAAAGCTTTCTGTAGTTGCTTCCTTTATCAGAAAAGAACATTTGATACCATGGTATATCATTTCCTCTTCATTAAAGAACAGCTTTTCTAAATGTTGGGGGAAATGTCCATAGTCATTACTCAGTCAAAACTTGTGTTCTCATGAGCCTAAGGACCATTCTAGATTTATTACGTGTTTTTTGTGTGTGTGTGTGTGTGTG