Transcript asmbl_68538

Sequence
Transcript Sequence for observation asmbl_68538 of TGE0003604:
CACTATTTGAGCGCATGCGCAAGACATGCTAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGTTGGCACCGTTCTGATCCCACCCAGCCCTCAGTGCCCCCGTGCTTGCCCCTCCCCTGCAGGCTCCCGCTGAGCCGGAGGCGGGCACGTCGGTACTGATGTGCTAGGGTAGTTCAGACCCCCTGCTCCGGGCAGGCGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACATGAGGGGAGGCGTGGGTAGGCCTCGGCCGAGCCCGCCGGCCAGCCTGAGAAGCCAGGCTGGCTGCTGGTGAATGTGAACGCTCCGGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAG