Transcript asmbl_68537

Sequence
Transcript Sequence for observation asmbl_68537 of TGE0002448:
CACTATTTGAGCGCATGCGCAAGACATGCTAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTCCTGGAGACGGTGGAGTTGCAGATCAGCTTGAAGAACTATGATCCCCAGAAGGACAAGCGCTTCTCGGGCACCGTCAGGCTTAAGTCCACTCCCCGCCCTAAGTTCTCTGTGTGTGTCCTGGGGGACCAGCAGCACTGTGACGAGGCTAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTGAAAAAACTCAACAAGAATAAAAAACTGGTCAAGAAGCTGGCCAAGAAGTATGATGCGTTTTTGGCCTCAGAGTCTCTGATCAAGCAGATTCCACGAATCCTCGGCCCAGGTTTAAATAAGGCAGGAAAGTTCCCTTCCCTGCTCACACACAACGAAAACATGGTGGCCAAAGTGGATGAGGTGAAGTCCACAATCAAGTTCCAAATGAAGAAGGTGTTATGTCTGGCTGTAGCTGTTGGTCACGTGAAGATGACAGACGATGAGCTTGTGTATAACATTCACCTGGCTGTCAACTTCTTGGTGTCATTGCTCAAGAAAAACTGGCAGAATGTCCGGGCCTTATATATCAAGAGCACCATGGGCAAGCCCCAGCGCCTATATTAAGGCACATTTGAATAAATTCTATTACCAG