Transcript asmbl_66651

Sequence
Transcript Sequence for observation asmbl_66651 of TGE0057622:
CACGTTCTCCAGGAACACCTTCAGAACACCACGAGTCTCCTCATAGATAAGGCCAGAAATTCGCTTGACACCGCCGCGACGAGCAAGGCGCCGGATAGCTGGCTTAGTGATGCCCTGGATGTTATCGCGCAAAACCTTGCGATGACGCTTAGCTCCTCCCTTACCCAAACCTTTTCCACCTTTACCACGGCCAGACATGACTAAGCAACTTCTAAAACCAACTTAAGAAACCTAAACGCCAAGGCAAAGCAACGCCCTTATATGCCGGGAATT