Transcript asmbl_66073

Sequence
Transcript Sequence for observation asmbl_66073 of TGE0056404:
AATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTGTAAGCTCCGTCCATCTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGAAACAACAGGAAAGAGTGAGGGAACAAATGGAAGTGGTGAACATGTCTCTGAGCACATCTGCGGACTCTCTGACAACACCTCGTCTAACTCTTTCAGAACTTGATGATATAATAAAGAATGCGTCAGGGATTTATGCAGAAATAGATGGAGCCAAAAGTGAACTACAAGTAAAACTATCTAACCTAAGTAACCTCAGCCATGATTTAGTCCAAGAAGCTATTGACCATGCACAGGACCTTCAACAAGAAGCTAATGAATTGAGCAGGAAGTTGCACAGTTCAGATATGAACGGGCTGGTACAGAAGGCTTTGGATGCATCAAATGTCTATGAAAATATTGTTAATTATGTTAGTGAAGCCAATGAAACAGCAGAATTTGCTTTGAACACCACTGACCGAATTTATGATGCGGTGAGTGGGATTGATACTCAAATCATTTACCATAAAGATGAAAGTGAGAACCTCCTCAATCAAGCCAGAGAACTGCAAGCAAAGGCAGAGTCTAGCAGTGATGAAGCAGTGGCTGACACTAGCAGGCGTGTGGGTGGAGCCCTAGCAAGGAAAAGTGCCCTTAAAACCAGACTCAGTGATGCCGTTAAGCAACTACAAGCAGCAGAGAGAGGGGATGCCCAGCAGCGCCTGGGGCAGTCTAGACTGATCACCGAGGAAGCCAACAGGACGACGATGGAGGTGCAGCAGGCCACTGCCCCCATGGCCAACAATCTAACCAACTGGTCACAGAATCTTCAACATTTTGACTCTTCTGCTTACAACACTGCAGTGAACTCTGCTAGGGATGCAGTAAGAAATCTGACCGAGGTTGTCCCTCAGCTCCTGGATCAGCTTCGTACGGTTGAGCAGAAGCGACCTGCAAGCAACGTTTCTGCCAGCATCCAGAGGATCCGAGAGCTCATTGCTCAGACCAGAAGTGTTGCCAGCAAGATCCAAGTCTCCATGATGTTTGATGGCCAGTCAGCTGTGGAAGTGCACTCGAGAACCAGTATGGATGACTTAAAGGCCTTCACGTCTCTGAGCCTGTACATGAAACCCCCTGTGAAGCGGCCGGAACTGACCGAGACTGCAGATCAGTTTATCCTGTACCTCGGAAGCAAAAACGCCAAAAAAGAGTATATGGGTCTTGCAATCAAAAATGATAATCTGGTATACGTCTATAATTTGGGAACTAAAGATGTGGAGATTCCCCTGGACTCCAAGCCCGTCAGTTCCTGGCCTGCTTACTTCAGCATTGTCAAGATTGAAAGGGTGGGAAAACATGGAAAGGTGTTTTTAACAGTCCCGAGTCTAAGTAGCACAGCAGAGGAAAAGTTCATTAAAAAGGGGGAATTTTCGGGAGATGACTCTCTGCTGGACCTGGACCCTGAGGACACAGTGTTTTATGTTGGTGGAGTGCCTTCCAACTTCAAGCTCCCTACCAGCTTAAACCTGCCTGGCTTTGTTGGCTGCCTGGAACTGGCCACTTTGAATAATGATGTGATCAGCTTGTACAACTTTAAGCACATCTATAATATGGACCCCTCCACATCAGTGCCATGTGCCCGAGATAAGCTGGCCTTCACTCAGAGTCGGGCTGCCAGTTACTTCTTCGATGGCTCCGGTTATGCCGTGGTGAGAGACATCACAAGGAGAGGGAAATTTGGTCAGGTGACTCGCTTTGACATAGAAGTTCGAACACCAGCTGACAACGGCCTTATTCTCCTGATGGTCAATGGAAGTATGTTTTTCAGACTGGAAATGCGCAATGGTTACCTACATGTGTTCTATGATTTTGGATTCAGCGGTGGCCCTGTGCATCTTGAAGATACGTTAAAGAAAGCTCAAATTAATGATGCAAAATACCATGAGATCTCAATCATTTACCACAATGATAAGAAAATGATCTTGGTAGTTGACAGAAGGCATGTCAAGAGCATGGATAATGAAAAGATGAAAATACCTTTTACAGATATATACATTGGAGGAGCTCCTCCAGAAATCTTACAATCCAGGGCCCTCAGAGCACACCTTCCCCTAGATATCAACTTCAGAGGATGCATGAAGGGCTTCCAGTTCCAAAAGAAGGACTTCAATTTACTGGAGCAGACAGAAACCCTGGGAGTTGGTTATGGATGCCCAGAAGACTCACTTATATCTCGCAGAGCATATTTCAATGGACAGAGCTTCATTGCTTCAATTCAGAAAATATCTTTCTTTGATGGCTTTGAAGGAGGTTTTAATTTCCGAACATTACAACCAAATGGGTTACTATTCTATTATGCTTCAGGGTCAGACGTGTTCTCCATCTCACTGGATAATGGTACTGTCATCATGGATGTAAAGGGAATCAAAGTTCAGTCAGTAGATAAGCAGTACAATGATGGGCTGTCCCACTTCGTCATTAGCTCTGTCTCACCCACAAGATATGAACTGATAGTAGATAAAAGCAGAGTTGGGAGTAAGAATCCTACCAAAGGGAAAATAGAACAGACACAAGCAAGTGAAAAGAAGTTTTACTTCGGTGGCTCACCAATCAGTGCTCAGTATGCTAATTTCACTGGCTGCATAAGTAATGCCTACTTTACCAGGGTGGATAGAGATGTGGAGGTTGAAGATTTCCAACGGTATACTGAAAAGGTCCACACTTCTCTTTATGAGTGTCCCATTGAGTCTTCACCATTGTTTCTCCTCCATAAAAAAGGAAAAAATTTATCCAAGCCTAAAGCAAGTCAGAATAAAAAGGGAGGGAAAAGTAAAGATGCACCTTCATGGGATCCTGTTGCTCTGAAACTCCCAGAGCGGAATACTCCAAGAAACTCTCATTGCCACCTTTCCAACAGCCCTAGAGCAATAGAGCACGCCTATCAATATGGAGGAACAGCCAACAGCCGCCAAGAGTTTGAACACTTAAAAGGAGATTTTGGTGCCAAATCTCAGTTTTCCATTCGTCTGAGAACTCGTTCCTCCCATGGCATGATCTTCTATGTCTCAGATCAAGAAGAGAATGACTTCATGACTCTATTTTTGGCCCATGGCCGCTTGGTTTACATGTTTAATGTTGGTCACAAAAAACTGAAGATTAGAAGCCAGGAGAAATACAATGATGGCCTGTGGCATGATGTGATATTTATTCGAGAAAGGAGCAGTGGCCGACTGGTAATTGATGGTCTCCGAGTCCTAGAAGAAAGTCTTCCTCCTACTGAAGCTACCTGGAAAATCAAGGGTCCCATTTATTTGGGAGGTGTGGCTCCTGGAAAGGCTGTGAAAAATGTTCAGATTAACTCCATCTACAGTTTTAGTGGCTGTCTCAGCAATCTCCAGCTCAATGGGGCCTCCATCACCTCTGCTTCTCAGACATTCAGTGTGACCCCTTGCTTTGAAGGCCCCATGGAAACAGGAACTTACTTTTCAACAGAAGGAGGATACGTGGTTCTAGATGAATCTTTCAATATTGGATTGAAGTTTGAAATTGCATTTGAAGTCCGTCCCAGAAGCAGTTCCGGAACCCTGGTCCACGGCCACAGTGTCAATGGGGAGTACCTAAATGTTCACATGAAAAATGGACAGGTCATAGTGAAAGTCAATAATGGCATCAGAGATTTTTCCACCTCAGTTACACCCAAGCAGAGTCTCTGTGATGGCAGATGGCACAGAATTACAGTTATTAGAGATTCTAATGTGGTTCAGTTGGATGTGGACTCTGAAGTGAACCATGTGGTTGGACCCCTGAATCCAAAACCAATTGATCACAGGGAGCCTGTGTTTGTTGGAGGTGTTCCAGAATCTCTACTGACACCACGCTTGGCCCCCAGCAAACCCTTCACAGGCTGCATACGCCACTTTGTGATTGATGGACACCCAGTGAGCTTCAGTAAAGCAGCCCTGGTCAGCGGCGCCGTAAGCATCAACTCCTGTCCAGCAGCCTGACATGACAGAGCACAGCTGCCCAAATACAAAGTTCTTTAGAGCACTGAAAGAAACACAAAGCCAGCCAGGAGGAACAGTAACTCTTCCTTCGGGTGGAAGCTTTCATCGAGTTGAACAGGACTTAAACGAATCATCAGGGACCGGATATTTCTTATTTCTCATTTGGATTCTTAACCTTGAATCCAAAGTGTCTGCAATGGACAACAATTGAAGGAGTGGCAAACTTACTTGTATTGAGAGCACACGCAATTCCTACTGGTGAAATTACTGTTTCTGTTTCTAATAAAATAGAAGGGATTCCAAATAAACACTTGCACACATTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTTTCTTCCAGGGAAGATAACTTTCAATCTATATAAAAATCTCTGTCCTAAAACTACCTTTCTTTATTTTGAAGAGACTTACTAACTTACATATAATCTAAATTAGATGATAGATTTGTTTTTAGCCCTTTTGTTTGGTCTATCAGTATAAGAAGAATATTTTAGGTTTATAGCTGAAGTTATCAAGGTTTAATAAAGTAAATTTCTAACAGAATACTAGAAAAATGCAGTATAATTTAATTTTTTCTAAATAAGAAACACAGGAAATCAACTACTTTTTCCCCTTCCTTATCTCCTTAAAAGAAAAATAAAATTGTACATGAGAGG