Transcript asmbl_65290

Sequence
Transcript Sequence for observation asmbl_65290 of TGE0002309:
AGAGGCTGACCGTTTCCGCTTCCGTCCACTTGGCGAGTGAGACGCTGATGGGAGGATGGACGTACTGGTGTCTGAGTGCTCCGCGCGGCTGCTGCAGCAGGAAGAAGAGATTAAATCTCTGACTGCTGAAATTGACCGGTTGAAAAACTGTGGCTGTTTAGGAGCTTCTCCAAATTTGGAGCAGTTACAAGAAGAAAATTTAAAATTAAAGTATCGACTGAATATTCTTCGAAAGAGTCTTCAGGCAGAAAGGAACAAACCAACTAAAAATATGATTAACATTATTAGCCGCCTACAAGAGGTCTTTGGTCATGCAATTAAGGCTGCATATCCAGATTTGGAAAATCCTCCTCTGCTAGTGACACCAAGTCAGCAGGCCAAGTTTGGGGACTATCAGTGTAATAGTGCTATGGGTATTTCTCAGATGCTCAAAACCAAGGAACAGAAAGTTAATCCAAGAGAAATTGCTGAAAACATTACCAAACACCTCCCAGACAATGAATGTATTGAAAAAGTTGAAATTGCTGGTCCTGGTTTTATTAATGTCCACTTAAGAAAGGATTTTGTATCAGAACAATTGACCAGTCTTCTAGTGAATGGAGTTCAACTACCTGCTCTGGGAGAGAATAAAAAGGTTATAGTTGACTTTTCCTCCCCTAATATAGCTAAAGAGATGCATGTAGGCCACCTGAGGTCAACTATCATAGGAGAGAGTATAAGCCGCCTCTTTGAATTTGCAGGGTATGACGTGCTCAGGTTAAATCATGTAGGAGACTGGGGGACCCAGTTTGGCATGCTCATCGCTCACCTGCAAGACAAATTTCCAGATTATCTAACAGTTTCACCTCCTATTGGGGATCTTCAGGTCTTTTATAAGGAATCTAAGAAGAGGTTTGATACTGAGGAGGAATTTAAGAAGCGAGCATATCAGTGTGTAGTTCTGCTCCAGGGTAAAAACCCAGATATTACAAAAGCTTGGAAGCTTATCTGTGATGTCTCCCGCCAAGAGTTAAATAAAATCTATGATGCATTGGACGTCTCTTTAATAGAGAGAGGGGAATCCTTCTATCAAGATAGGATGAATGATATTGTAAAGGAATTTGAAGATAGAGGATTTGTGCAGGTGGATGATGGCAGAAAGATTGTATTTGTCCCAGGGTGTTCCATACCATTAACCATAGTAAAATCAGATGGAGGTTATACCTATGATACATCTGACCTGGCTGCTATTAAACAAAGACTATTTGAGGAAAAAGCAGATATGATTATCTATGTTGTGGACAATGGACAATCTGTGCACTTCCAGACAATATTTGCTGCTGCTCAAATGATTGGTTGGTATGACCCTAAAGTAACTCGAGTCTTCCATGCTGGATTTGGTGTGGTGCTAGGGGAAGACAAGAAAAAGTTTAAAACACGTTCGGGTGAAACAGTGCGCCTCATGGATCTTCTGGGAGAAGGACTAAAACGATCCATGGACAAGTTGAAGGAAAAAGAAAGAGACAAGGTCTTAACTGCAGAGGAATTGAATGCTGCTCAGACATCCGTTGCGTATGGCTGCATCAAATATGCTGACCTTTCCCATAACCGGTTGAATGACTACATCTTCTCCTTTGACAAAATGCTAGATGACAGAGGAAATACAGCTGCTTACTTGTTGTATGCCTTCACTAGAATCAGGTCTATTGCACGTCTGGCCAATATTGATGAAGAAATGCTCCAAAAAGCTGCTCGAGAAACCAAGATTCTTTTGGATCATGAGAAGGAATGGAAACTAGGCCGGTGCATTTTACGGTTCCCTGAGATTCTGCAAAAGATTTTAGATGACTTATTTCTCCACACTCTCTGTGATTATATATATGAGCTGGCAACTGCTTTCACAGAGTTCTATGATAGCTGCTACTGTGTGGAGAAAGATAGACAGACTGGAAAAATATTGAAGGTGAACATGTGGCGTATGCTGCTATGTGAAGCAGTAGCTGCTGTCATGGCCAAGGGGTTTGATATCCTGGGAATAAAACCTGTCCAAAGGATGTAATCCTTCATAGGTTTGAACACTGTGTGTTTTTACCAAAGTGGCCATTGGCACTGTTTGCTTTTTTACAATCATGTGGACACAAGCATAAGTAAAGAAAATTTGTCAACCAGG