Transcript asmbl_2060

Sequence
Transcript Sequence for observation asmbl_2060 of TGE0008443:
GTATATGCAGTTCAGTGGCTCCCTGCACACCAAGCTCTACCAGGAGGTGGAGATTGCCAGTGTGGATGCGTTCCAGGGGCGCGAGAAGGACTTCATCATCCTCTCCTGCGTGCGGGCCAATGAGCACCAAGGCATTGGGTTTTTAAACGACCCCAGACGGCTTAATGTGGCCCTAACCCGAGCGCGATACGGGGTCATCATTGTGGGGAACCCCAAGGCCCTATCCAAGCAGCCACTCTGGAACCACCTGCTGAATTACTACAAGGAGCAGAAGGTGCTGGTGGAGGGGCCCCTGAACAACCTGCGAGAGAGCCTAATGCAATTCAGCAAGCCCCGGAAGCTGGTCAACACCATCAACCCTGGAGCTCGCTTCATGACCACAGCCATGTATGACGCCCGGGAGGCCATCATCCCAGGATCAGTTTATGATCGGAGCAGCCAGGGTCGGCCCTCGAACATGTACTTCCAGACCCATGACCAGCTCGGCATGATCAGTGCTGGCCCCAGCCACGTGGCTGCCATGAACATTCCCATCCCCTTCAACCTGGTCATGCCACCCATGCCACCCCCGGGGTATTTTGGACAGGCTAACGGGCCAGCTGCAGGCCGGGGCACCCCAAAAGGCAAAACGGGTCGTGGCGGACGCCAGAAGAACCGCTTTGGGCTTCCTGGGCCCAGCCAGACAAACCTGCCCAGCAGCCAGGCCAGCCAGGATGTGGCATCACAGCCCTTCTCACAGGGTGCCCTGACGCAGGGCTATATCTCCATGAGCCAGCCCTCCCAGATGAGCCAGCCTGGCCTCTCCCAACCTGAGCTGTCCCAGGACAGTTACCTTGGTGATGAGTTTAAGTCCCAGATTGATGTGGCGCTGTCGCAAGACTCCACATACCAGGGAGAGCGGGCATACCAGCACGGCGGAGTGACGGGCCTGTCCCAGTACTAGAAGGTGGCAGCAGAAGAGCTAAGCTATGTGGCTTAGTCCATCAGCATCTTATTCTGGGTAATAAAAAATAAAAATAAATGGATACCTGTTTTCCACTGCTAAAACTGAAGCACCACTGTGAGCAACAGGAGAGGGAGAGGAGCACCCGAGGGAGAGCAGCCCGAGATAGCGAGCGCCCACTGCTGGCACCGCGGCGAGGAGACGAGAGGGAGAGTGGAGGTGGGGCCGGCCCGCCCGCGAGCCCTGCAGCCCGCTCGCCAACGAGGCCCAGCTCGCCGCGTCCATACCTGGGTCTACGACCAGGTGGAGGGAGGAAGACCCTCATCTCAGAGTAGCCCTTTCCTCTGTTTTTTCTTTCTTTTTCTCTTTTATTGAAAGGGGACTACGTTTTTGCAGGAATAACTTGCATTTCTGTGCTGAGCAGGCTCCTTGCAGGTGGCGACCACACCCAGAGAGCCCTGAAGAGTCTCGGGTTCTGTCCGTGCCATCTGAGACCATGCGGTCATGCTGCCTGTGTTCTAAGAGGGTTTTCATTTAAAGAAAATATGGTGTTTTGGGTTTTCTGTTTGTTTTTTTAAAGATTCTTTCAAAGGAGTACTGGAAAATACACTTTACTGAGTTTGTCTCTCAAACCTTAGTGGTGGACCTGGGAAATGCAAGAAGCTTCCAGAAATGAAGTTTAAACGAGCAACACAACGAGGTTAGGATCAACACCTGTGACGCGATCATGGAGAGGATTTTTGTTTTCAGTTTAGCTTCCAGCAGCTTCTCCCTGCGCATCAGGGCAGTGAGGAAGCGCTGCCCCGGCCGATGGGCAGCTCTATGAGCTCTGCTGGACTCCAAGAAGCAAGGTGCTTCCCACGAGCAACGGACTCAGCCCCCCGAGGGACCCCGGCAGGACTGACCATGTGGCCGGAGGGCGGGAAGGTGGCTGTTCCCTGCTGGTGTGGCTTCTCCAGGGTTCTTTGGAGGATTTGGCAGAAGACAGCAGCCAAGAGGAGCCTTTTCCAAGGAGGCGCCCACAGTCACTGTGACTGTCGGACAAGCCAAGCACCATCCCTTCCCTGCCCCATTCTCCACCCCACTCCCAAGTTTGGAGCCCTTCTACCTATGGGCTCAGCTTCAGTGAGGTGGGATGGTTTCTGCTTTTGGGGGAAAAGTTTCAGAAATAAGTTGGTTCTATGCTGAAGGTGCTTGGAGGAGCTTGTCACATCAGCTGGTATAGGGGCATTGGTGTGGGTTTGCATTGCAGAAGTTCTGGCTGGGAGAGCCCCCTACCCTTGTTCCTTGCACACCATGGGGGTGTTTGATCATCTCCCTGGTGGCCACCTAGTTGGGGACTGTCCCCTGCCAACCCAGACCCTAGTAACCTTGACCCCCCAGCGTCCCCTCCCTGTGCGCCTGATATTGGCCCTTATCCGAAAGCCTCCAGATGCCAGCTGGTACACAGGAACACACAGGCACCTTCCTTCTGGCAAGGCCTCTTATTTATCCCATTGCTGTAGGATTTTCAATCCCCTTCTTTTGGTAGGCAGCCTAGAGGCATCTGGCTTGAATAGGCTTCGGCTGTGACCCTGTGCACCCACCCACCACCCTGTTCCTTCCTTGGAGTGCTCTGCCTCACTGTGCTGTTGGCTTTGTTCACCTTCTAGCAGCAATTACTCTTGTGAGTTTTCCAAATCAAAGAGCATCTGTACCAAGGCAGTGTCACTTCTGATTTTTGGTCAATTTGTTTTAAGCTCTTTTGTCACCAATAAAATCTTAAACAACTCTTG