Transcript asmbl_2058

Sequence
Transcript Sequence for observation asmbl_2058 of TGE0008443:
GTATATGCAGTTCAGTGGCTCCCTGCACACCAAGCTCTACCAGGAGGTGGAGATTGCCAGTGTGGATGCGTTCCAGGGGCGCGAGAAGGACTTCATCATCCTCTCCTGCGTGCGGGCCAATGAGCACCAAGGCATTGGGTTTTTAAACGACCCCAGACGGCTTAATGTGGCCCTAACCCGAGCGCGATACGGGGTCATCATTGTGGGGAACCCCAAGGCCCTATCCAAGCAGCCACTCTGGAACCACCTGCTGAATTACTACAAGGAGCAGAAGGTGCTGGTGGAGGGGCCCCTGAACAACCTGCGAGAGAGCCTAATGCAATTCAGCAAGCCCCGGAAGCTGGTCAACACCATCAACCCTGGAGCTCGCTTCATGACCACAGCCATGTATGACGCCCGGGAGGCCATCATCCCAGGATCAGTTTATGATCGGAGCAGCCAGGGTCGGCCCTCGAACATGTACTTCCAGACCCATGACCAGCTCGGCATGATCAGTGCTGGCCCCAGCCACGTGGCTGCCATGAACATTCCCATCCCCTTCAACCTGGTCATGCCACCCATGCCACCCCCGGGGTATTTTGGACAGGCTAACGGGCCAGCTGCAGGCCGGGGCACCCCAAAAGGCAAAACGGGTCGTGGCGGACGCCAGAAGAACCGCTTTGGGCTTCCTGGGCCCAGCCAGACAAACCTGCCCAGCAGCCAGGCCAGCCAGGATGTGGCATCACAGCCCTTCTCACAGGGTGCCCTGACGCAGGGCTATATCTCCATGAGCCAGCCCTCCCAGATGAGCCAGCCTGGCCTCTCCCAACCTGAGCTGTCCCAGGACAGTTACCTTGGTGATGAGTTTAAGTCCCAGATTGATGTGGCGCTGTCGCAAGACTCCACATACCAGGGAGAGCGGGCATACCAGCACGGCGGAGTGACGGGCCTGTCCCAGTACTAGAAGGCAAGCCGGCCCCAGAGGAGGGCTTCACCAGGACCTGGACTTTTGGGGAAACT