Transcript asmbl_62263

Sequence
Transcript Sequence for observation asmbl_62263 of TGE0057571:
CTCGGGGCCGCGAAGGGATGTGACGAGCGGCGCGCTGTGCATTGTGGGAAGCCGGCCGCGAGGACTGGTTCCAGTTCACTCGGCAGCGGCGCCGGGCGGAGGGGGAGAGCGCGGGCCGCGCGGGCGGGAAGCGAAGAGGCGGGCGGGCCAGCGAGGAGCGCGGAGAGAAAAGGCGCGAGCGGCCAGGAGGGCTCAGGCCGAGACACCTTGCAGCTGCCGCCGCCGCCACCGAGCCGCCGCTGTGCTCACTGATCCGCCTCCAGGGCCACCGCCATGTCGAGCCGCGGTGGGAAGAAGAAGTCCACCAAGACGTCCAGGTCTGCCAAAGCAGGAGTCATCTTTCCCGTGGGGCGGATGCTGCGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAGCGGAGATTCTGGAGCTGGCTGGCAATGCAGCGAGAGACAACAAGAAGGGACGGGTCACACCCCGGCACATCCTGCTGGCTGTGGCCAATGATGAAGAGCTGAATCAGCTGCTAAAAGGAGTCACCATAGCCAGTGGGGGTGTGTTACCCAACATCCACCCCGAGTTGCTAGCGAAGAAGCGGGGATCCAAAGGAAAGTTGGAAGCCATCATCACACCACCCCCAGCCAAAAAGGCCAAGTCTCCATCCCAGAAGAAGCCTGTATCTAAAAAAGCAGGAGGCAAGAAAGGGGCCCGGAAATCCAAGAAGCAGGGTGAAGTCAGTAAGGCAGCCAGCGCCGACAGCACAACCGAGGGCACACCTGCCGACGGCTTCACAGTCCTCTCCACCAAGAGCCTCTTCCTTGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACAGTGATGCTGTCGTTCACCCGACAAACACTGACTTCTACATCGGTGGTGAAGTAGGAAACACGCTGGAGAAGAAAGGTGGCAAGGAGTTTGTGGAAGCTGTCCTGGAACTCCGGAAAAAGAACGGGCCCTTGGAAGTAGCTGGAGCTGCTGTCAGCGCAGGCCATGGCCTGCCTGCCAAGTTTGTGATCCACTGTAATAGTCCAGTTTGGGGTGCAGACAAGTGTGAAGAACTTCTGGAAAAGACAGTGAAAAACTGCTTGGCCCTGGCTGATGATAAGAAGCTGAAATCCATTGCATTTCCATCCATCGGCAGCGGCAGGAACGGTTTTCCAAAGCAGACAGCAGCTCAGCTGATTCTGAAGGCCATCTCCAGTTACTTCGTGTCTACAATGTCCTCTTCCATCAAAACGGTGTACTTCGTGCTTTTTGACAGCGAGAGTATAGGCATCTATGTGCAGGAAATGGCCAAGCTGGACGCCAACTAGGCTGAGCAATGACAGAACCAGCTGCACCATGTACCCCACCTTCAGTTTAAAAGAAAAAAAAAATCCCCTTCACTCCTACTGGGAGGTGGGACCCCTTTCATTTTCAGTTTTGCTCATCTAGGGAAAATAAGGCTTTGGTTTCCAGTTTAATTGTTTTTGACCTTCTAAAATGTTTTTATGTTAGCACTGATAGTTGGCATTACTGTTGTTAAGCACTGTGTTCCAGACCGTGTCTGACTTAGTGTAACCTAGGAGATTTTATAGTTTTATTTTAATGAAACCCTGATTGACGCACAGCAGTGGGGAGAACAGCGTCTTTTACCTGTCACCGAAGCCAGGAAGCCCCGTTTGTAAGCGTGTGTTGTGGTGCTTTATTGTACATCCTCCAGTGGCGTTCTTTTTACTCTAATGTTCTTTTGGTTTCCCCCCTCAGAAGAATCATGAATTTGCAACAGACCTAATTTTTGGTTACTTTTTGTCTTATTGATGGATTTGAAAATGAAAGATTTAATAAGGCAAAGCAGAATCTGTTGTCCTTAATTATATTTGCAATTTGGAATTTGTGTGAGTTGATTTAGTAAAATGTTAAACCGTT