Transcript asmbl_55836

Sequence
Transcript Sequence for observation asmbl_55836 of TGE0007602:
TCGGGCGCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCCGCGGATTATAACAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAGAGCAACTGGAATGAGATTGTTGATAACTTTGATGATATGAATTTAAAGGAGTCTCTCCTTCGTGGCATCTATGCTTACGGTTTTGAGAAGCCTTCCGCTATTCAGCAGAGAGCTATTATTCCCTGTATTAAAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGATCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCCACTTGTCATGCCTGCATTGGTGGAACAAATGTTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCCGGGAGAGTGTTTGATATGTTAAACAGAAGATACCTTTCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATGAAATGTTGAGCCGTGGTTTTAAGGATCAAATCTATGAGATTTTCCAAAAACTAAACACAAGTATTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAGATCCAATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAGAGAGAGGAATGGAAGTTGGATACACTTTGTGACTTGTACGAGACACTGACCATTACACAGGCTGTTATTTTTCTCAATACGAGGCGCAAGGTGGACTGGCTGACTGAGAAGATGCATGCCAGAGACTTCACAGTTTCTGCTCTGCATGGTGACATGGACCAGAAGGAGAGAGATGTTATCATGAGGGAATTCCGGTCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGCTCGCGGGATTGATGTGCAACAAGTGTCTTTGGTTATAAATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGGGATGAGAGTTTTGGATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGATTTTGATAGCAAAGCGACGTTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAGTAGAAAGGCCTTTAAAATTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCCTAGGTAGGGTTTAATCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAA