Transcript asmbl_54849

Sequence
Transcript Sequence for observation asmbl_54849 of TGE0001787:
CCAGGCTATAAACCGCCGGTTAGGGGCCGCCATCCCCTCAGAGCGTCGGGATATCGGGTGGCGGCTCGGGACGGAGGACGCGCTAGTGTTCTTCTGTGTGGCAGTTCAGAATGATGGATCAAGCTAGATCAGCATTCTCTAACTTGTTTGGTGGAGAACCATTGTCATATACCCGGTTCAGCCTGGCTCGGCAAGTAGATGGCGATAACAGTCATGTGGAGATGAAACTTGCTGTAGATGAAGAAGAAAATGCTGACAATAACACAAAGGCCAATGTCACAAAACCAAAAAGGTGTAGTGGAAGTATCTGCTATGGGACTATTGCTGTGATCGTCTTTTTCTTGATTGGATTTATGATTGGCTACTTGGGCTATTGTAAAGGGGTAGAACCAAAAACTGAGTGTGAGAGACTGGCAGGAACCGAGTCTCCAGTGAGGGAGGAGCCAGGAGAGGACTTCCCTGCAGCACGTCGCTTATATTGGGATGACCTGAAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTCACCGGCACCATCAAGCTGCTGAATGAAAATTCATATGTCCCTCGTGAGGCTGGATCTCAAAAAGATGAAAATCTTGCGTTGTATGTTGAAAATCAATTTCGTGAATTTAAACTCAGCAAAGTCTGGCGTGATCAACATTTTGTTAAGATTCAGGTCAAAGACAGCGCTCAAAACTCGGTGATCATAGTTGATAAGAACGGTAGACTTGTTTACCTGGTGGAGAATCCTGGGGGTTATGTGGCGTATAGTAAGGCTGCAACAGTTACTGGTAAACTGGTCCATGCTAATTTTGGTACTAAAAAAGATTTTGAGGATTTATACACTCCTGTGAATGGATCTATAGTGATTGTCAGAGCAGGGAAAATCACCTTTGCAGAAAAGGTTGCAAATGCTGAAAGCTTAAATGCAATTGGTGTGTTGATATACATGGACCAGACTAAATTTCCCATTGTTAACGCAGAACTTTCATTCTTTGGACATGCTCATCTGGGGACAGGTGACCCTTACACACCTGGATTCCCTTCCTTCAATCACACTCAGTTTCCACCATCTCGGTCATCAGGATTGCCTAATATACCTGTCCAGACAATCTCCAGAGCTGCTGCAGAAAAGCTGTTTGGGAATATGGAAGGAGACTGTCCCTCTGACTGGAAAACAGACTCTACATGTAGGATGGTAACCTCAGAAAGCAAGAATGTGAAGCTCACTGTGAGCAATGTGCTGAAAGAGATAAAAATTCTTAACATCTTTGGAGTTATTAAAGGCTTTGTAGAACCAGATCACTATGTTGTAGTTGGGGCCCAGAGAGATGCATGGGGCCCTGGAGCTGCAAAATCCGGTGTAGGCACAGCTCTCCTATTGAAACTTGCCCAGATGTTCTCAGATATGGTCTTAAAAGATGGGTTTCAGCCCAGCAGAAGCATTATCTTTGCCAGTTGGAGTGCTGGAGACTTTGGATCGGTTGGTGCCACTGAATGGCTAGAGGGATACCTTTCGTCCCTGCATTTAAAGGCTTTCACTTATATTAATCTGGATAAAGCGGTTCTTGGTACCAGCAACTTCAAGGTTTCTGCCAGCCCACTGTTGTATACGCTTATTGAGAAAACAATGCAAAATGTGAAGCATCCGGTTACTGGGCAATTTCTATATCAGGACAGCAACTGGGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGCTGAGAAAACAGACAGATTTGTCATGAAGAAACTCAATGATCGTGTCATGAGAGTGGAGTATCACTTCCTCTCTCCCTACGTATCTCCAAAAGAGTCTCCTTTCCGACATGTCTTCTGGGGCTCCGGCTCTCACACGCTGCCAGCTTTACTGGAGAACTTGAAACTGCGTAAACAAAATAACGGTGCTTTTAATGAAACGCTGTTCAGAAACCAGTTGGCTCTAGCTACTTGGACTATTCAGGGAGCTGCAAATGCCCTCTCTGGTGACGTTTGGGACATTGACAATGAGTTTTAAATGTGATACCCATAGCTTCCATGAGAACAGCAGGGTAGTCTGGTTTCTAGACTTGTGCTGATCGTGCTAAATTTTCAGTAGGGCTACAAAACCTGATGTTAAAATTCCATCCCATCATCTTGGTACTACTAGATGTCTTTAGGCAGCAGCTTTTAATACAGGGTAGATAACCTGTACTTCAAGTTAAAGTGAATAACCACTTAAAAAATGTCCATGATGGAATATTCCCCTATCTCTAGAATTTTAAGTGCTTTGTAATGGGAACTGCCTCTTTCCTGTTGTTGTTAATGAAAATGTCAGAAACCAGTTATGTGAATGATCTCTCTGAATCCTAAGGGCTGGTCTCTGCTGAAGGTTGTAAGTGGTCGCTTACTTTGAGTGATCCTCCAACTTCATTTGATGCTAAATAGGAGATACCAGGTTGAAAGACCTTCTCCAAATGAGATCTAAGCCTTTCCATAAGGAATGTAGCTGGTTTCCTCATTCCTGAAAGAAACAGTTAACTTTCAGAAGAGATGGGCTTGTTTTCTTGCCAATGAGGTCTGAAATGGAGGTCCTTCTGCTGGATAAAATGAGGTTCAACTGTTGATTGCAGGAATAAGGCCTTAATATGTTAACCTCAGTGTCATTTATGAAAAGAGGGGACCAGAAGCCAAAGACTTAGTATATTTTCTTTTCCTCTGTCCCTTCCCCCATAAGCCTCCATTTAGTTCTTTGTTATTTTTGTTTCTTCCAAAGCACATTGAAAGAGAACCAGTTTCAGGTGTTTAGTTGCAGACTCAGTTTGTCAGACTTTAAAGAATAATATGCTGCCAAATTTTGGCCAAAGTGTTAATCTTAGGGGAGAGCTTTCTGTCCTTTTGGCACTGAGATATTTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATGGTGTTTTTTTAATAGAATATAATTATCGGAAGCAGTGCCTTCCATAATTATGACAGTTATACTGTCGGTTTTTTTTAAATAAAAGCAGCATCTGCTAATAAAACCCAACAGATACTGGAAGTTTTGCATTTATGGTCAACACTTAAGGGTTTTAGAAAACAGCCGTCAGCCAAATGTAATTGAATAAAGTTGAAGCTAAGATTTAGAGATGAATTAAATTTAATTAGGGGTTGCTAAGAAGCGAGCACTGACCAGATAAGAATGCTGGTTTTCCTAAATGCAGTGAATTGTGACCAAGTTATAAATCAATGTCACTTAAAGGCTGTGGTAGTACTCCTGCAAAATTTTATAGCTCAGTTTATCCAAGGTGTAACTCTAATTCCCATTTTGCAAAATTTCCAGTACCTTTGTCACAATCCTAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAAAGAACAAGGTAGTTTTTACCTACCACAGTGTCTGTATCGGAGACAGTGATCTCCATATGTTACACTAAGGGTGTAAGTAATTATCGGGAACAGTGTTTCCCATAATTTTCTTCATGCAATGACATCTTCAAAGCTTGAAGATCGTTAGTATCTAACATGTATCCCAACTCCTATAATTCCCTATCTTTTAGTTTTAGTTGCAGAAACATTTTGTGGTCATTAAGCATTGGGTGGGTAAATTCAACCACTGTAAAATGAAATTACTACAAAATTTGAAATTTAGCTTGGGTTTTTGTTACCTTTATGGTTTCTCCAGGTCCTCTACTTAATGAGATAGTAGCATACATTTATAATGTTTGCTATTGACAAGTCATTTTAACTTTATCACATTATTTGCATGTTACCTCCTATAAACTTAGTGCGGACAAGTTTTAATCCAGAATTGACCTTTTGACTTAAAGCAGAGGGACTTTGTATAGAAGGTTTGGGGGCTGTGGGGAAGGAGAGTCCCCTGAAGGTCTGACACGTCTGCCTACCCATTCGTGGTGATCAATTAAATGTAGGTATGAATAAGTTCGAAGCTCCGTGAGTGAACCATCATTATAAACGTGATGATCAGCTGTTTGTCATAGGGCAGTTGGAAACGGCCTCCTAGGGAAAAGTTCATAGGGTCTCTTCAGGTTCTTAGTGTCACTTACCTAGATTTACAGCCTCACTTGAATGTGTCACTACTCACAGTCTCTTTAATCTTCAGTTTTATCTTTAATCTCCTCTTTTATCTTGGACTGACATTTAGCGTAGCTAAGTGAAAAGGTCATAGCTGAGATTCCTGGTTCGGGTGTTACGCACACGTACTTAAATGAAAGCATGTGGCATGTTCATCGTATAACACAATATGAATACAGGGCATGCATTTTGCAGCAGTGAGTCTCTTCAGAAAACCCTTTTCTACAGTTAGGGTTGAGTTACTTCCTATCAAGCCAGTACGTGCTAACAGGCTCAATATTCCTGAATGAAATATCAGACTAGTGACAAGCTCCTGGTCTTGAGATGTCTTCTCGTTAAGGAGATGGGCCTTTTGGAGGTAAAGGATAAAATGAATGAGTTCTGTCATGATTCACTATTCTAGAACTTGCATGACCTTTACTGTGTTAGCTCTTTGAATGTTCTTGAAATTTTAGACTTTCTTTGTAAACAAATGATATGTCCTTATCATTGTATAAAAGCTGTTATGTGCAACAGTGTGGAGATTCCTTGTCTGATTTAATAAAATACTTAAACACTGA