Transcript asmbl_54580

Sequence
Transcript Sequence for observation asmbl_54580 of TGE0001771:
CGGAAGTTCCACGTCAGTCAGTCTGACGGTCAGTGGATCGGTGGGTTTATCTCAAGGCCTGAGTAGCCGGTAACAAACGAGGGTTCCCGGGATTGGACCGACGCAGCCATGCCTCTGCGACTTGATATCAAAAGAAAGCTAACTGCTAGATCTGATCGAGTTAAGAGTGTGGATCTGCATCCTACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACAGGAGCGGATGACATGCAGATTAGAGTGTTCAATTACAATACTCTGGAGAGAGTTCATATGTTTGAAGCACACTCAGACTACATTCGCTGTATTGCTGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCCTCTTTGGACAGGACTATCAAGGTGTGGCAGTTGGGCTCTTCGTCACCAAACTTCACTTTGGAAGGACATGAGAAAGGCGTGAATTGCATTGATTACTACAGTGGTGGGGACAAGCCATACCTCATTTCAGGTGCAGATGACCGTCTTGTTAAAATATGGGATTATCAGAATAAAACATGTGTGCAGACACTGGAAGGACATGCCCAAAATGTGTCTTGTGCCAGCTTTCATCCTGAGTTGCCAATCATTATCACAGGTTCAGAAGATGGAACAGTACGTATTTGGCATTCAAGCACCTACCGGCTTGAGAGCACACTGAATTATGGAATGGAGAGGGTATGGTGCGTGGCCAGTCTAAGAGGGTCAAACAATGTCGCTTTGGGCTATGATGAAGGGAGCATCATTGTTAAGCTTGGTCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCATTCAGAAGTCCAGCAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGTGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACTATTCAGCACAATCCTAATGGGCGGTTTGTGGTGGTGTGTGGTGATGGGGAGTATATCATCTACACAGCAATGGCATTGAGAAACAAGAGCTTTGGATCTGCTCAGGAGTTTGCATGGGCCCACGATTCTTCAGAGTATGCAATAAGAGAGAGCAACAGCATTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGATTTTGGAGCAGAAAGTATCTACGGCGGCTTCTTATTGGGAGTCAGATCTGTAAATGGCTTAGCCTTCTATGACTGGGACAATACAGAACTCATACGAAGAATTGAAATTCAGCCCAAACATATTTTCTGGTCTGACTCTGGAGAGCTAGTCTGTATTGCTACTGAGGAATCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTCTTGGCTGCACAGGAAACACATGAGGGAGTTACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAGATTCAGGAAATTGTGAAAACAGGGCTTTGGGTAGGCGATTGCTTCATTTACACAAGTTCTGTGAACAGATTAAATTATTATGTTGGAGGAGAAATAGTCACCATTGCCCACTTGGACAGGACGATGTATCTCCTAGGCTACATTCCTAAAGACAACAGGCTTTATCTGGGGGATAAAGAATTGAACATCATTAGCTATTCCCTGCTGGTTTCAGTCCTGGAATACCAGACAGCTGTCATGCGGAGGGACTTTAGCATGGCTGATAAGGTCCTTCCTACCATTCCAAAAGAACAGAGGACCAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAAGCTCTTACAGTATCCACAGATCCTGAGCATCGTTTTGAGCTTGCTCTTCAGCTTGGAGAGTTAAAAATTGCATACCAGTTAGCAGTGGAAGCAGAGTCAGAACAGAAGTGGAAACAACTTGCTGAACTTGCCATTAGTAAATGTCAGTTTGGCCTAGCCCAGGAGTGCCTGCATCATGCACAGGATTATGGGGGCCTGCTGCTTTTGGCCACTGCCTCTGGAAATGCTAATATGGTGAACAAGCTAGCAGAGGGTGCGGAGAGAGATGGCAAAAATAATGTGGCATTCATGAGCTACTTTTTACAGGGCAAGGTTGATGCCTGCCTAGAGCTCTTAATTAGAACTGGACGGCTGCCAGAAGCTGCCTTCTTGGCCCGAACTTACTTACCCAGTCAGGTTTCAAGGGTAGTGAAACTCTGGAGAGAGAATCTCTCAAAAGTCAATCAGAAAGCAGCAGAATCCCTTGCTGACCCAACAGAGTATGAAAACCTGTTCCCTGGATTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGGAAACACATGCTGATCTGTGGCCAGCCAAACAATACCCACTTGTCACGCCAAATGAAGAGAGAAATGTCATGGAAGAGGGAAAAGACTTTCAGCCCTCAAGATCTACAGCTCAACAGGAACTTGATGGGAAACCTGCTTCTCCTACTCCGGTTATTGTGGCCTCCCACACAGCCAACAAAGAAGAAAAGAGTTTACTCGAACTAGAAGTAGATTTGGATAATTTGGAATTAGAAGATATTGACACAACAGATATCAATCTGGATGAAGATATTTTGGATGATTGACTGTAATGCTTTCCATTTACCTGACTAAACAGATCATTATTATATATAGGTATTGATTGCTACCCTGACCACAGTGCTTTGGACTATGAGAAACTTCTTAGATTTTTATATGTAAATGCTGTGGACCACTGGGAGCACAATGCCCACATCATCTTAAGAAGAGTTTATGTGCAGCATTTAAATCACTGTGTTTTCCTTGTTAACTAAAACAGACATGGGCTTTGATTTTTTTCATACTATTAGACCATATCTCATAAAACCTTTTGAATTAATGAAGGTACTTGTTTCCTTTCTCAATAATGAAAATAGGCTTCTAGTTTTAGAAGGCTGAGCCGAAACTACACCTTGCCTAGGGATCAGCCCCACTGTCTTTTCTTTGTATAACTAAATCTGCATTTTCAAATGTTGTCAATCACATTTTTCTTAGAGCTGAATATCCAGGCTGTAATTCTCTAAACCCTTTTTCTTGACCTCATTGCATCATTCCACAGGTCTTGCCCCGATTTTGTCTAGCAGCTACCCATTTCTGGAGTCAGGATGTGAAACCTCTGTTCCTCTGACCTCATTAAGCTGGGGGTCTGTCTAAGTTAACGTTTGCCCTATTTGGTAACACAAAAACACACCAGACTTTTTAACCGTACGCTCATCTAACATGATTTGAGAAATTCATAACCAGGCACTCAAATATCCTTGTAGCCTACGAAAAGTGAGTAGGGTAATAATTTTTGCTTTGTAGGGAGAACTACAAATTGATATCTTTTAATCTGGCCATTTTTTAACATTTAGCTCAATATTAACAGAGAAATGTAGTCAGTATTTAGTAAAATAAATGTATTTTTAAAATATTTTTAGGAAGCTGCAGAATGGCGACTGAGTGCTTCTTGATAAGTCTGCAGTGTTAGTTCTATATAGGCTCCCTTCTGTGCTTCTGTTTTTGCAAAGACCT