Transcript asmbl_54110

Sequence
Transcript Sequence for observation asmbl_54110 of TGE0001731:
CCGTGATGCCCCACGCGGCTGCAATGATTGGTTAAGGGTTTTGCTTTTAGGGCGTGGACGGGCTCCTGAGCAATAGTGGATGAGCTGTGAGTGCGCGCGCGTGCGCGGGGCCGCGACCTGTGCCGGCTCGAGCCCGCTGGGCACTCGGAGGCGCGCACGTCGTTCCCCGCCCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGACTCGCGGACCGGCGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATACTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACCCCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGATCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAACCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCTAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCTTGCTGCAAGCACAGCCCTTATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCTTGCTACCAGTATTTAGAAGCCAACTATGATTATTAACGATGTCCAACCCGTCTGGCCCACCAGGGTCCTTTTGACACTGCTCTAACAGCCCTCCTCTGCACTCCCACCTGACACACCAGGCGCTAATTCAAGGAATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAACAGTTGGTAACTTTTGTGAATTAGGCTGTAACTACTTTATAACTAACATGTCCTGCCTATTATCTGTCAGCTGCAAGGTACTCTGGTGAGTCACCACTTCAGGGCTTTACTCCGTAACAGATTTTGTTGGCATAGCTCTGGGGTGGGCAGTTTTTTGAAAATGGGCTCAACCAGAAAAGCCCAAGTTCATGCAGCTGTGGCAGAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGTCATCCTCAAAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGGAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCACTTTTTCTGATAAAAGATGGCCATATTACCCCTTTTCGGCCCCATGTATCTCAGTACCCCATGGAGCTGGGCTAAGTAAATAGGAATTGGTTTCACGCCTGAGGCAATTAGACACTTTGGAAGATGGCATAACCTGTCTCACCTGGACTTAAGCATCTGGCTCTAATTCACAGTGCTCTTTTCTCCTCACTGTATCCAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCATGGGTGGCACTCAGTCTCTCTTCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAA