Transcript asmbl_51902

Sequence
Transcript Sequence for observation asmbl_51902 of TGE0001625:
GGGCCATTTCCGCTGCTGCTTCTGTGAGTTTTTCCGGTGCACGCGAGTGCTTCTGAAACGTCAGCTGCGCTCCCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAAACCTGTGGCCTCTGCCACGTGCTCCCTGCCAGCTTCCCCCCTGAGGTTGTGTATCATATTATCTGTGTTAGCATGTAGTATTTTCAGCTACTCTCTATTGTTATAAAATGTAGTACTAAATCTGGTTTCTGGA