Transcript asmbl_49908

Sequence
Transcript Sequence for observation asmbl_49908 of TGE0057460:
GGGGGGGCGGGGGCGTGGCCTCTGGAGCCTGGTTCCGCGCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGATCAGTCTGCTGCAGCCGCAGGTGGAGGAGTCTGTGCTCAACCTGGGCAAATTCCACAGCATCGTTCGTCTGGTGGCCTTTTGTCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGAAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACCCACCTGCCGTCCAAAAAGAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCCGCAATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAGGAGTCATAGCTGAGATCCTGCGAGGAGTTCGTCTGCACTTCCACAATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACACAGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATCAACGACAATGCCACATACTGCCGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATGAGGACAAGCTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCACGGTCCTCCATGGGCATGGACATATCTGCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATACCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTGCCCACAATCAGGTGCCACTTCTGGTGCCCACTGCTTGTTGGGGGATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCAAGTTTCCAGAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGAGGTGCCCACGAGTGTATTCGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGTTCAGGCAGAGGAAGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTTGCCCTCGCGTCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAGGAGATGAGTGAAAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCTCTTTCTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGCGATCTTGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAGGAAGAAGTCTACACCCAAGGAGGAAACAGTTAATGACCCTGAGGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAATTCTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGTTGGCAAGAGCAGCTCCAAGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTCTGGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTGTGCCGTGTTCCCCAATAAAAACAAATTCACAAG