Transcript asmbl_49907

Sequence
Transcript Sequence for observation asmbl_49907 of TGE0057459:
GGGGGGGCGGGGGCGTGGCCTCTGGAGCCTGGTTCCGCGCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGCTGTTGCACGTGCTGTTTGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGATCAGTCTGCTGCAGCCGCAGGTGGAGGAGTCTGTGCTCAACCTGGGCAAATTCCACAGCATCGTTCGTCTGGTGGCCTTTTGTCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGAAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACCCACCTGCCGTCCAAAAAGAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCCGCAATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAGGAGTCATAGCTGAGATCCTGCGAGGAGTTCGTCTGCACTTCCACAATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACACAGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATCAACGACAATGCCACATACTGCCGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATGAGGACAAGCTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCACGGTCCTCCATGGGCATGGACATATCTGCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATACCGCCAGAGCCTACACACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTTCTCTGAGGTGCCCACGAGTGTATTCGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGTTCAGGCAGAGGAAGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTTGCCCTCGCGTCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAGGAGATGAGTGAAAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCTCTTTCTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGCGATCTTGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAGGAAGAAGTCTACACCCAAGGAGGAAACAGTTAATGACCCTGAGGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAATTCTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGTTGGCAAGAGCAGCTCCAAGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTCTGGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTGTGCCGTGTTCCCCAATAAAAACAAATTCACAAG