Transcript asmbl_20365

Sequence
Transcript Sequence for observation asmbl_20365 of TGE0004100:
CCGGGCCTAGGCGCGAGCCCGGAGCGCTGAATCCGCGCTTCGGCCCCGGAGCCGCGGTCTCCCGCCATGGGTCTCTGTCTCTTCCTCTACCGCGCACCCCTGCTTCTGTGGGGCCTACTGTTTCTCCTGCTGCTTGCAGTCTCGGCTCTCCAGGCTGGACGTCCGTCCCCTGTGGTCCTGGTGCCTGGTGATTTGGGCAACCAGCTGGAGGCAAAGCTGGACAAGCCAAAGGTCGTGCACTACCTCTGCTCCAAGAAAACAGACAGCTACTTCACACTCTGGCTGAACCTTGAACTGCTGCTGCCTGTCATCATTGACTGCTGGATCGACAATATCAGGCTGGTGTACAATAGAACGTCCCGGACCACCCAGTTTCCTGATGGTGTGGATATGCATGTCCCTGGCTTTGGGAAGACCTTTGCACTGGAGTTTCTGGACCCCAGCAAAAGCAGTGTGGGTTCCTATTTCCACACTATGGTGGAGAGCCTTGTGGGCTGGGGCTACACACGGGGTAAGGATGTCCGGGGGGCCCCCTATGACTGGCGCCGAGCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGGGAGATGATCGAGGAGATGCATCAGCTGTATGGGGGCCCCGTGGTGCTGGTTGCCCACAGTATGGGCAACATGTACACGCTCTACTTTCTGCAGCGGCAGCCACAGGCCTGGAAGGACAAGTACATCCGTGCCTTCTTGGCACTGGGTGCGCCTTGGGGGGGCGTGGCCAAGACCCTACGCGTTCTGGCCTCAGGAGACAACAATCGGATCCCGGTCATTAGTCCCCTGAAGATCCGGGAGCAGCAGCGATCTGCTGTCTCTACCAGCTGGCTCCTGCCCTATAACTATACCTGGTCACCTGAGAAGGTCTTCGTGCGCACACCCACGGCCAACTACACGCTGCGCGACTATCACCGGTTCTTCCAGGACATTGGCTTTGAAGATGGCTGGCTCATGCGGCAGGACACGGAAGGGCTGGTAGATGTCACAATGCCACCTGGCGTACAGCTGCACTGCCTCTATGGCACTGATGTCCCCACGCCGGACTCCTTCTACTATGAGAGCTTCCCGGACCGCGACCCTAAAATCTACTTTGGCGATGGTGATGGCACTGTGAACTTGCAGAGTGCCCTGCATTGCCAGACCTGGCGCAACCACCAGGCACACCAAGTATCATTGCAGGCGCTGCCAGGCAGTGAGCATATTGAAATGCTGGCCAATGCCACCACTCTGGCCTATCTGAAACGCATGCTCTTTGGGCCCTGATTCCTGTCCCAGCCAGGGCTGCGCGATGGCTCGGCTACAGCTGCTTCTCTTGGACTCTGGGGCTGCGATGGCCCATGAGTTTAGCAGTTTGTGACTGACCATCCAAGGTCCTGAGTCTTTGGTTGTGAAACATCTTCCATATGAAGTGCTGTTTCTTATCCTTTCTCTGGGAGGGAGGAAGGAAGAAATAGTCTAGACTCACTTGAGGGACCCTTAATGGAAAGAATGCTGCTGCTGATGGAATTGTGACCTCAGGACTGGCTCTGCAGGTGGATTGGCTGGCACCTGGATCCAATCCCCAACTCAGGGGCCATGTGTTCCTCCTATGCCTGTGGCCTTTTCACATTTACCCACCAGGCCTGGCCCCTCAGCCTTCCTGTAAGTGATATGACTAAGCTGTGGTTCCTACCCCCACAGGCCCCAGGAATGGGCTCCTGGTCCCTAGGGTGACCCTTCCCACACACTGGCCACAGGTGAGCCTACTACTGGCCATGGGTGGCTGGAGCTGCTGGCTTCCTTGTAGCATAGCTGCTTGACAGTCTGACTGGCTTTCTGAGGGCAGTCCAGTTTCCCCTGCAGGCAGGGGCAGATTGTTGTGTTCTCTGTGGTTCTCAGGCTCTGGGGCATTCACTCTTACCTCCCTCACCTCTAAAAACAGCCTAGCTCAGGATTGGGCAGCAGATGGCCCCTTAGTTCTGCAGCCATGGCCCAGGAGCTCTGATCCCCTTGGTCGGGCTGTTTCCCACAGTACTGATGTTAGCTTCCTTTACCTTGGGACTATGGTTCAAGGATAAGAGCAGGGCCCAGTGCCATGGCCTTTTAGGTCCTCATGAAGAAAGAAAACTTAAGGACACAGACAAGATGATTCGGAGTTTCTCTGAACTGCCCTCTTGCTAACTCTACCACCATACTGCCACCCTTCCCCACGGTTTCTCTAGTACCCAAGTGGGCTGGCACAGAGTCGAAAGGAGACAGGGCTTCTGCCCATCCTGCCCAGCACATACCTCCACCAGGCAGCTCAGTGGTGTTTAGTCTGCAGGGACAGCTCAGAACATACTTTGGGACCCTGTGAGACCCAGGTGCCTTGGAGCCCCCTTGGGGGTTTCTGTCTGCCTCAGAGGTGCTGCATGAGTCTCCTTGTGATAGCAGGGCTGGAGAATCTGGATTTACCTTGGTGGCAGTGGTCTCCAAGTAGGCGACAGCTATAAGCCAAGACTTGGGTCTAGCCTCTAGGGTGAGGCCCCAAAGCCACAGTCAGACTAGACTGTGCTGTTCTCCCACAAGATTTCTGTGGAGCCGGATTTTCTCTGTTGTGTACATACCCAGCATCTGTCTCTCCCTTTGTTTCTGAGTGGTGGGCCTCACCTGCATGGGGCTCTGAGCAGGCTGTACCTCGATTCTGGCAATAAAAGTATTCTGGATACTGTAAAGTACCTTGAGAGGTGGGAAGTGGT