Transcript asmbl_25662

Sequence
Transcript Sequence for observation asmbl_25662 of TGE0000880:
ACACAACTTGGGGCCCCTCTCCTCTCCAGCCCTTCTCCTGTGTGCCTGCCTCCTGCCGCCGCCACCATGACCACCTCCATCCGCCAGTTCACCTCCTCCAGCTCCATCAAGGGCTCCTCCGGCCTGGGGGGCGGCTCGTCCCGCACCTCCTGCCGGCTGTCTGGCGGCCTGGGTGCCGGCTCCTGCAGGCTGGGATCTGCTGGCGGCCTGGGCAGCACCCTCGGGGGTAGCAGCTACTCCAGCTGCTACAGCTTTGGCTCTGGTGGTGGCTATGGCAGCAGCTTTGGGGGTGTTGATGGGCTGCTGGCTGGAGGTGAGAAGGCCACCATGCAGAACCTCAATGACCGCCTGGCCTCCTACCTGGACAAGGTGCGTGCCCTGGAGGAGGCCAACACTGAGCTGGAGGTGAAGATCCGTGACTGGTACCAGAGGCAGGCCCCGGGGCCCGCCCGTGACTACAGCCAGTACTACAGGACAATTGAGGAGCTGCAGAACAAGATCCTCACAGCCACCGTGGACAATGCCAACATCCTGCTACAGATTGACAATGCCCGTCTGGCTGCTGATGACTTCCGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGAGCTGCAGTCCCAGCTCAGCATGAAAGCATCCCTGGAGGGCAACCTGGCGGAGACAGAGAACCGCTACTGCGTGCAGCTGTCCCAGATCCAGGGGCTGATTGGCAGCGTGGAGGAGCAGCTGGCCCAGCTTCGCTGCGAGATGGAGCAGCAGAACCAGGAATACAAAATCCTGCTGGATGTGAAGACGCGGCTGGAGCAGGAGATTGCCACCTACCGCCGCCTGCTGGAGGGAGAGGATGCCCACCTGACTCAGTACAAGAAAGAACCGGTGACCACCCGTCAGGTGCGTACCATTGTGGAAGAGGTCCAGGATGGCAAGGTCATCTCCTCCCGCGAGCAGGTCCACCAGACCACCCGCTGAGGACTCAGCTACCCCGGCCGGCCACCCAGGAGGCAGGGAGGCAGCCGCCCCATCTGCCCCACAGTCTCCGGCCTCTCCAGCCTCAGCCCCCTGCTTCAGTCCCTTCCCCATGCTTCCTTGCCTGATGACAATAAAGCTTGTTGACTCAGC