Transcript asmbl_49663

Sequence
Transcript Sequence for observation asmbl_49663 of TGE0057450:
CTGTCAGTGAGCCTGCGCAGGAGGCCAATAGGCTGCCAATACTCCTTGGACTCCCCGCCAGGGCCCTGCTGTCAGTGCGCCTGCGCGCGGGTCCGGCGCCGAGGTTCTTGACTGCTGTGCCGGACGCCAGGTGTAGCCATGCAGCGAGCCGATTCCGAGCAGCCCTCCAAGCGTCCCCGTTGCGATGACAGCCCGAGAACCCCCTCAAACACCCCTTCCGCAGAGGCAGACTGGTCCCCGGGCCTGGAACTCCATCCCGACTACAAGACATGGGGTCCGGAGCAGGTGTGCTCCTTCCTCAGGCGCGGTGGCTTTGAAGAGCCGGTGCTGCTGAAGAACATCCGAGAAAATGAAATCACAGGCGCATTACTGCCTTGTCTTGATGAGTCTCGTTTTGAAAATCTTGGAGTAAGTTCCTTGGGGGAGAGGAAGAAGCTGCTTAGTTATATCCAGCGATTGGTTCAAATCCACGTTGATACAATGAAGGTAATTAATGATCCTATCCATGGCCACATTGAGCTCCACCCTCTCCTCGTCCGAATCATTGATACACCTCAATTTCAACGTCTTCGATACATCAAACAGCTGGGAGGTGGTTACTATGTTTTTCCAGGAGCTTCACACAATCGATTTGAGCATAGTCTAGGGGTGGGGTATCTAGCAGGATGTCTAGTTCACGCACTGGGTGAAAAACAACCAGAGCTGCAGATAAGTGAACGAGATGTTCTCTGTGTTCAGATTGCTGGACTTTGTCATGATCTCGGTCATGGGCCATTTTCTCACATGTTTGATGGACGATTTATTCCACTTGCTCGCCCGGAGGTGAAATGGACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGAAGCCTATACTAAGCTGACAGATAACATTTTTCTGGAGATTTTATACTCTACTGATCCCAAATTGAAAGACGCACGAGAGATTTTAAAACAAATTGAATACCGTAATCTATTCAAGTATGTGGGTGAGACGCAGCCAACAGGACAAATAAAGATTAAAAGGGAGGACTATGAATCTCTTCCAAAAGAGGTTGCCAGTGCTAAACCCAAAGTATTGCTAGACGTGAAACTGAAGGCTGAAGATTTTATAGTGGATGTTTCACAACTTCTGCCAGAGAAATTTGCAGAGCAGCTGATTCGAGTATATTGTAAGAAGGTGGACAGAAAGAGTTTGTATGCCGCAAGACAATATTTTGTTCAGTGGTGTGCAGACAGAAATTTCACCAAGCCGCAGGATGGCGATGTTATAGCCCCACTCATAACACCTCAAAAAAAGGAATGGAACGACAGTACTTCAGTCCAAAATCCAACTCGCCTCCGAGAAGCATCCAAAAGCAGAGTCCAGCTTTTTAAAGATGACCCAATGTGAATGTCTGTAGTCAGTTGTTTACAAACTCCCTCTCCTGCACAATTCATTTAGAGGCTTCAATCATAGAATTCTGCAAATTAATGACAACTCATGCTTTAATTTTGTATTTTGAATGTACACGCATGCTGAAGCTAAGTAACTTTTAATCAAAGAAATAAGATGGTATTAGGCAAATCTTACTATACTATGAAAAGCATTACCTTGCCTATTTTTAATATTATTAAAGCCTTTCTCCTTCAGTAGTCTATTTTCTTAGAATAACAACTCTTTTATCTATTCTGAACTCTATTTTTTTTCTTTTTTAAGAGACAAGGTTTTGCTCTGTTGCCCAGCTTGGACTCGAACTTTCCTGGGCTCAAGCGACCCTCCTGCCTCAGCCCCCCAAGTAGCTGGGACTAAAGTCATGTGCCACCACACCCAGCTTACTCTGAACTTTTATGACAGATGATTGTTTTTTGTTTTTAATGTAGAAATGAGACAAGGGTACAAATTGGAACTAGAAATTGACATTGTCATTGACAAACATGGCTAAAAACAAAACATCAAATCCTGCCCCCGTGAAGAGTTCCCTGTCACCTCAAGTTTGAGGATAGTCCTCTAAGAGTGACCTAAGCATAAGTGAAAGACACCTCCCCTCACCCTTCTAGCCCCCTACAAGGTGCCAGGTTGGGGTAAAGAGTTGGAGATGATGGCCAGGAGTGGCCTCCAACACGCTGGTGAGAGGCCTGATTAGGTTTTGGGGAAGATCTGAGAGCTCTGGCCTCTTCGTGAGTGGAACATAAAGCCGCCTCTTGTTGGGAGATCCTACCCCAGTGACAGAGGAATCCCCCAAACTAGGCTGTGCCCTGGCTCCGTGGCGGCTCCAGACCCGGGTAGTGCCTTTGTCCCCTGAATACTCACTCCCCCGGTCCAGAGGGCCTTCCCACTGCCCAGCCTGGAGAAGGCCTCCCCTGACCTGCTCTCTCAGTATCCTGGAGAGCTGGCCAGAGGCCATCACAGGCATCATCCTCAGAGCTCCTCAGACCTGGGACTTTGTTTTTGCTGGTTCAGTGCATTTTGTGTATTTAAGAGCAAACACTAGCCAGGCGTGGCGGCGTGTGCCTGTAGTCCCAGCTA