Transcript asmbl_48183

Sequence
Transcript Sequence for observation asmbl_48183 of TGE0003178:
GAGAATGAAATGTTTCCCATCATAGTGGATTCTTAAGCACGTTCTCCACGTATGCGGCGTGCTAGCTGGATGTCTTTTGGCATAATTGTTACACGTTTGGCATGGATAGCACACAGGTTGGTGTCTTCAAAAAGGCCAACCAGATAGGCCTCACTTGCCTCCTGCAAAGCACCGATAGCTGCGCTCTGGAAGCGCAGATCTGTTTTAAAGTCCTGAGCAATTTCTCGCACCAGACGCTGGAAGGGAAGTTTGCGAATCAGAAGTTCAGTGGACTTCTGATAACGTCTAATTTCACGGAGCGCCACAGTACCAGGCCTGTAACGATGAGGTTTCTTCACCCCTCCAGTAGAGGGCGCACTCTTGCGAGCGGCTTTTGTAGCCAGTTGCTTCCTGGGTGCTTTACCACCGGTCGATTTGCGGGCAGTCTGCTTTGTACGAGCCATGGTACAGAGACCTCCTTACTTACCCCCCTTCTCCTTCGGCTGGAGCTCGGCGAGCGAGAGGCGGCGCTGGCGTTGGAGAGCGACGGCGGCGCGGCGGCGGCTGCGAAC