Transcript asmbl_44210

Sequence
Transcript Sequence for observation asmbl_44210 of TGE0001400:
CCGGGCGCGGACGCGGGCACGCACACACGCAAGCACGCCTCCACTTAACTCGCGCCGCCGCGGCAGCTCGAGTCCACCAGCAGCGCCGTCCGCTTGACCGAGATGCTGCGGGCCTGTCAGTTATCGGGTGTGACCGCCGCCGCCCAGAGTTGTCTCTGTGGGAAGTTTGTCCTCCGTCCATTGCGACCATGCCGCAGATACTCTACTTCAGGCAGCTCTGGGTTGACTACTGGCAAAATTGCTGGAGCTGGCCTTTTGTTTGTTGGTGGAGGTATTGGTGGCACTATCCTATATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATACCTTACTCAGACAAACTCTTCGAGATGGTTCTTGGTCCTGCAGCTTATAATGTTCCATTGCCAAAGAAATCGATTCAGTCGGGTCCACTAAAAATCTCTAGTGTATCAGAAGTAATGAAAGAATCTAAACAGCCTGCCTCACAACTCCAAAAACAAAAGGGAGATACTCCAGCTTCAGCAACAGCACCTACAGAAGCGGCTCAAATTATTTCTGCAGCAGGTGATACCCTGTCGGTCCCAGCCCCTGCAGTTCAGCCTGAGGAATCTTTAAAAACTGATCACCCTGAAATTGGTGAAGGAAAACCCACACCTGCACTTTCAGAAGAAGCATCCTCATCTTCTATAAGGGAGCGACCACCTGAAGAAGTTGCAGCTCGCCTTGCACAACAGGAAAAACAAGAACAAGTTAAAATTGAGTCTCTAGCCAAGAGCTTAGAAGATGCTCTGAGGCAAACTGCAAGTGTCACTCTGCAGGCTATTGCAGCTCAGAATGCTGCGGTCCAGGCTGTCAATGCACACTCCAACATATTGAAAGCCGCCATGGACAATTCTGAGATTGCAGGCGAGAAGAAATCTGCTCAGTGGCGCACAGTGGAGGGTGCATTGAAGGAACGCAGAAAGGCAGTAGATGAAGCTGCCGATGCCCTTCTCAAAGCCAAAGAAGAGTTAGAGAAGATGAAAAGTGTGATTGAAAATGCAAAGAAAAAAGAGGTTGCTGGGGCCAAGCCTCATATAACTGCTGCAGAGGGTAAACTTCACAACATGATAGTTGATCTGGATAATGTGGTCAAAAAGGTCCAAGCAGCTCAGTCTGAGGCTAAGGTTGTATCTCAGTATCATGAGCTGGTGGTCCAAGCTCGGGATGACTTTAAACGAGAGCTGGACAGTATTACTCCAGAAGTCCTTCCTGGGTGGAAAGGAATGAGTGAGTACAACTGAACTGACAAGCTCTCTACTGATGATCTGAACTCCCTCATTGCTCATGCACATCGTCGTATTGATCAGCTGAACAGAGAGCTGGCAGAACAGAAGGCCACCGAAAAGCAGCACATCACGTTAGCCTTGGAGAAACAAAAGCTGGAAGAAAAGCGGGCATTTGACTCTGCAGTAGCAAAAGCATTAGAACATCACAGAAGTGAAATACAGGCTGAACAGGACAGAAAGATAGAAGAAGTCAGAGATGCCATGGAAAATGAAATGAGAACCCAGCTTCGCCGACAGGCAGCTGCCCACACTGATCACTTGCGAGATGTCCTTAGGGTACAAGAACAGGAATTGAAGTCTGAATTTGAGCAGAACCTGTCTGAGAAACTCTCTGAACAAGAATTACAATTTCGTCGTCTCAGTCAAGAGCAAGTTGACAACTTTACTCTGGATATAAATACTGCCTATGCCAGACTCAGAGGAATCGAACAGGCTGTTCAGAGCCATGCAGTTGCTGAAGAGGAAGCCAGAAAAGCCCACCAACTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAACACCTACTATCCCGCTGGGTAGTGCAGTTGAGGCCATCAAAGCCAACTGTTCTGATAATGAATTCACCCAAGCTTTAACCGCAGCTATCCCTCCAGAGTCCCTGACCCGTGGGGTGTACAGTGAAGAGACCCTTAGAGCCCGTTTCTATGCTGTTCAAAAACTGGCCCGAAGGGTAGCAATGATTGATGAAACCAGAAATAGCTTGTACCAGTACTTCCTCTCCTACCTACAGTCCCTGCTCCTATTCCCACCTCAGCAACTGAAGCCGCCCCCAGAGCTCTGCCCTGAGGATATAAACACATTTAAATTACTGTCATATGCTTCCTATTGCATTGAGCATGGTGATCTGGAGCTAGCAGCAAAGTTTGTCAATCAGCTGAAGGGGGAATCCAGACGAGTGGCACAGGACTGGCTGAAGGAAGCCCGAATGACCCTAGAAACGAAACAGATAGTGGAAATCCTGACAGCATATGCCAGCGCCGTAGGAATAGGAACCACTCAGGTGCAGCCAGAGTGAGGTTTAGGAAGATTTTCATAAAGTCATATTTCATGTCAAAGGAAATCAGCAGTGATAGATGAAGGGTTCGCAGCGAGAGTCCCGGACTTGTCTAGAAATGAGCAGGTTTACAAGTACTGTTCTAAATGTTAACACCTGTTGCATTTATATTCTTTCCATTTGCTATCATGTCAGTGAACGCCAGGAGTGCTTTCTTTGCAACTTGTGTAACATTTTCTGTTTTTTCAGGTTTTACTGATGAGGCTTGTGAGGCCAATCAAAATAATGTTTGTGATCTCTACTACTGTTGATTTTGCCCTCGGAGCAAACTGAATAAAGCAACAAGATGAAAACTGAGTATCTTATCCCTTTTCAAAAAGTACAGTTCTGGCCAGGTGCAGTAGC