Transcript asmbl_20351

Sequence
Transcript Sequence for observation asmbl_20351 of TGE0004098:
CCGGAAGTGGAGGCGGTTGGTGAAGTTGGAGGGGCTCAGGGACGCGGTGCGGGCCGCGGTTTGTGGGCTGCGGGTGGTGACCAGCATCCTGCTGTCTGGCCCCGGTGCGGCTGTACTCGGCTGGATAGTGCGCAGCGGCAGCGACACGAACCCGGCGCGGACAGGGCGCCCGTGGCTGGGCCCATGGCCTCCTGCGCGAGCATCGACATCGAGGACGCCACGCAGCACCTACGGGACATCCTCAAGCTGGACCGGCCCACGGGGGGCCCCAGTTCAGAGAGCCAACGGCCATCTAACGCCTACAATGGGGACCTCAATGGACTCCTGGTCCCAGACCCCCTCTGCTCAGGTGATGGTACTTCAGCAAACAAGCCTGGTCTCCGGGCCATGCCACCTATTAACCTGCAGGAGAAGCAGGTCATCTGCCTTTCAGGAGATGACAGCTCTACCTGCATTGGGATTTTGGCCAAGGAGGTGGAGATTGTGGCCAGCAGTGACTCTAGCATCTCGAGCAAGGCACGAGGGAGCAACAAGGTGAAAATCCAGCCTGTTGCCAAGTATGACTGGGAGCAGAAATACTACTACGGCAACCTGATTGCTGTGTCCAACTCCTTCTTGGCCTATGCCATTCGGGCTGCCAACAATGGCTCAGCGATGGTGCGGGTGATCAGCGTCAGCACTTCGGAACGGACCTTACTCAAGGGCTTCACAGGCAGTGTGGCTGACCTGACCTTTGCACACCTCAACTCTTCACAGCTGGCCTGCCTGGATGAGGCAGGCAACCTGTTTGTGTGGCGCTTGGCTCTGGTTAATGGCAAAATTCAAGAAGAGATTTTGGTTCATATCCGGCAGCCAGAGGGTACACCACTGAACCACTTTCGTAGAATCATCTGGTGCCCCTTCATCCCTGAGGAGAGTGAGGATTGCTGTGAGGAGGGCAGCCCAACGGTGGCCCTGTTGCATGAAGACCGGGCTGAGGTGTGGGACCTAGACATGCTCCGCTCCAACCACAGCACCTGGCCTGTGGATGTCAGCCAAATCAAGCAGGGCTTCATTGTGGTGAAAGGCCATAGCACATACCTGAGTGAAGGGGCCCTCTCACCTGATGGGACTGTCCTGGCCACTGCAAGCCATGATGGCTTCATCAAATTCTGGCAGATCTACATTGAGGGGCAGGATGAGCCAAGGTGTCTGCACGAGTGGAAGCCTCATGATGGGCGGCCCCTTTCCTGCCTCCTATTCTGTGACAACCACAAGAAACAGGACCCTGATGTCCCTTTCTGGAGGTTCCTCATTACTGGCGCTGACCAGAATCGGGAGCTGAAGATGTGGTGCACAGTGTCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTTCCCCCTAGCCTCAAAGTTTGCCTGGACCTCTCAGCAGAATACCTGATTCTCAGTGATGTGCAACGGAAGGTCCTCTACGTGATGGAGCTGCTGCAGAACCAGGAGGAGGGCCGTGCCTGCTTCAGCTCCATCTCTGAGTTCCTGCTTACCCACCCTGTCCTGAGCTTTGGTATCCAGGTCGTGAGTCGCTGCCGACTGCGGCACACTGAGGTGCTGCCTGCCGAGGAAGAGAACGACAGCCTAGGGGCTGATGGGACCCACGGAGCTGGTGCCATGGAGTCTGCAGCTGGTGTGCTCATCAAGCTCTTCTGTGTGCATACTAAGGCTTTGCAAGATGTGCAGATCCGCTTTCAGCCACAGCTAAACCCTGATGTGGTGGCCCCGCTCCCTACCCACACTGCCCATGAGGACTTTGCATTTGGAGATTCTCAGCCTGAACTGAGCTCCGGGGGGCTGGGATCAGCTGCTCATGGCTCCCAGCCTGACCTCCGACGCATTGTGGAGCTGCCTGCACCTGCTGACTTCCTTAGTCTGAGCACTGAGACCAAGCCCAAGCTGATGACACCTGATGCTTTCATGACATCTAGCACCTCCCTGCAGCAGATCTCTGCATCCCCTAGTAATAGCAGCGGCGGCAGCAGCAGTGGTAGCAGCAGCAGCAGCAGCAGCTCCTCTCTTACAGCTGTGTCTGCCATGAGCAGTACCTCGGCTGTGGACACCTCCTTGTCCAGGCCCCCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGTTTGACAATGAGCAGCAGTAGCAGCCTGCAGGCAAGCCCACGCAGCCTCCTGCCCGGCCTGTTACCAGGTCCAGCTGACAAATTGACTCCCAAAGGGCCTGGGCAGGTGCCTACTGCTGCCTCTGGACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAGGCTTCCCCTAGCCGTACTCGCTCCCCTGATGTTATTTCCTCAGCTTCCACTGCCCTGTCCCAGGATATCCCTGAGATCGCGTCTGAGGCCCTGTCCCGTGGCTTTGGCTCCTCTGCTCCTGAGGGCCTTGAACCGGACAGTATGGCCTCAGCTGCTTCAGCACTACACTTGCTGTCCCCACGGCCACGGCCCGAGCTTGGGCCCCAGCTTAGCCTGGATGGAGGCCCTGGGGATGGGGATCGGCATAGTACCCCTTCCCTCCTGGAGGCAGCCTTGACCCAAGAGGCTACAGCCTCTGACAGTCAGGTCTGGCCAACAGCACCAGACATTACTCGGGAGACCTGCAGCAGCCTGGCAGAAAGCCCTAGGAATGGCCTTCAGGAAAAGCACAAGAGCTTGGCCTTCCACCGACCGCCTTATCATCTGCTGCAGCAACATGACAGCCAGGATGCCAGTGCTGAACAAAGTGACCATGATGATGAGGTGGCCAGCATTGCCTCTGCTGCAGCGGGCTTTGGCACCAAAGTTTCCACTCCACGGCTTCCTGCCAAGGACTGGAAGACCAAGGGATCTCCTCGGGCCTCACCTAAGCTCAAGAGGAAGGGCAAAAAGGATGATGGGTAGGAGGGGTCCTGGGGCCAGGGAGAGGGGTGGTCCCCAGGCTGTCTAGGCCTGAGGTGCTTCTCGCCTGTGGCAGGGATTCGACTGCGGGATCCCGGCTCATGGAGCACCAGGTGACAGAGCCCCCTGAGGATTGGCCTGCAATAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAAAAAGAGCTACTGCAGCGTCTGTGCACCCAGCTCGAAGGCCTGCAGAGTACCGTCACAGGCCATGTAGAACGTGCCCTCGAGTCCCGGCATGAACAGGAGCAGCGGCGGTTGGAGCGGGCACTGGCAGAAGGGCAGCAGCGGGGTGGGCAGCTACAAGAGCAGCTGACGCAACAGCTGTCACAGGCACTGTCTTCAGCTGTGGCTGGGAGGCTGGAACGCAGCATACGGGATGAGATCAAGAAGACAGTGCCTCCATGTGTCTCTAGGAGTCTGGAACCCGTGGCAGGCCAACTGAGCAACTCAGTGGCCACCAAACTCACAGCTGTGGAGGGTAGCATGAAAGAGAATATCTCCAAGCTGCTGAAGTCCAAGAACTTAACAGACGCTATTGCCCGAGCAGCTGCAGACACGTTACAAGGGCCAATGCAGGCTGCCTACCGTGAAGCCTTCCAGAGTGTGGTGCTGCCTGCCTTCGAGAAGAGCTGCCAGGCCATGTTCCAACAGATCAATGATAGCTTCCGACTGGGCACACAGGAATACTTGCAGCAGCTAGAGAGCCACATGAAGAGCCGGAAGGCACGAGAACAGGAGGCGCGGGAGCCTGTGTTGGCCCAGCTGCGGAGCCTGGTCAGCACACTGCAGGGTGCCACTGAGCAGATGGCAGCCACTGTGTCTAACAGTGTTCGGGCTGAGGTGCAACACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCAATTTTAGCACAGGTACAGCGCATTGTTAAGGGTGAGGTGAGTGTGGCACTCAAGGAGCAGCAGGCCTCCGTCACCTCTAGCATCATGCAAGCCATGCGCTCAGCTGCAGGCACACCTGTCCCAGCTGCCCACCTCGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCCCTCACGGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGGCCAGGTTTTTGGGCAGCCACCCTGCCCACTCTCCCAGCCCGTGCTCCTTTCCTTCATCCAGCAGCTGGCCTCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCTGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGTTCCGTCATGGCCCAGGTGCGCCAGAAGTTATTCCAGTTCCTGCAGGCTGAGCCATACAACTCACTTGGCAAAGCGGCCCGGCGTCTTAGCCTCATGTTGCATGGCCTTGTGACCCCCACCCTCCCTTAGCAAAGCCTGCCTTGCCCAGGGGTGCAGTGGCATTGAAGACCAGCAGACAGGCCTAGACCAAAGCAGGGTCATGTCTGCCCTTTATCTGCTCAGGCTCCCACCTCTGGGGTAGTTGAGAGGGGGAACACTGGCTGTAGTCTACAGGTTATGGTAGCCAGCAGGTTTAGGCTGAGCCCAGGGTGGGTATTGTGCCTTCTTGGGTTCTGCCATGCCTGGAGCATGACCCCCTGAGATTGTGATACCACTTGAGTTGAATTTTCCATGTTCCTTTTTACCTCTGTTTTGGATCTTTCTGTTTTTGAAAAACATTGAGAAATTCAATTAAATGCTTTTGGAATAAAA