Transcript asmbl_43758

Sequence
Transcript Sequence for observation asmbl_43758 of TGE0001355:
GGGGTAGGCTGACACGGGAGGGTCCTCAGCTAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGCGCTCGCCCTCGCTCTCCTCGCCCTCCGCCCCGGCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATGCAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAGATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATTGCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCAGAAGGGGCTGAAAACTAAATCCATACAGGGTGTCATCCTTCTTTCCTTCAAGAAACCTTTTTACACATCTCCATTCCTTATTCCACTTGGATTTCCTATAGCAAAGAAACCCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTTCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCTGGTGTGCAGTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATAAACATAAGTAACTCCCAAACACTTATGTAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAAATAAGAAAATGTAGTTAATTACAATTTAAAGAGTATTCCACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTCGGGGGTTTCCTTTCAGTAAGCAACTTTTCCATGCTCTTAATGTATTCCTTTTTAGTAGGAATCCGGAAGTATTAGATTGAATGGAAAAGCACTTGCCATCTCTGTCTAGGGGTCACAAATTGAAATGGCTCCTGTATCACATACGGAGGTCTTGTGTATCTGTGGCAACAGGGAGTTTCCTTATTCACTCTTTATTTGCTGCTGTTTAAGTTGCCAACCTCCCCTCCCAATAAAAATTCACTTACACCTCCTGCCTTTGTAGTTCTGGTATTCACTTTACTATGTGATAGAAGTAGCATGTTGCTGCCAGAATACAAGCATTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAAGTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACCCATATTTTAAGGGACAGGTGAATTTACTACTTTCTAAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTAGTGATACCTATATTTCCACATTGTGCATTGTGACACACTTGTCTAGGGATGCCTGGAAGTGTATAAAATTGGACTGCATTTCTTAGAGTGTTTTACTATAGATCAGTCTCATGGGCCATCTCTTCCTCAGATGTAAATGATATCTGGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGCAAAGTTAA