Transcript asmbl_43421

Sequence
Transcript Sequence for observation asmbl_43421 of TGE0057402:
CCGCCCCTTTCAGGCCTAGCAGGAAACGAAGCGGCTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTAACTCCATTCCTGGTATAGAATCCCCATTTGAACAAGCAAAGAAGGTGATAACCATGTTTGTACAGCGACAGGTGTTTGCTGAGAACAAGGATGAGATTGCTTTAGTCCTGTTTGGTACAGATGGCACTGACAATCCCCTTTCTGGTGGGGATCAGTATCAGAACATCACAGTGCACAGACATCTGATGCTACCAGATTTTGATTTGCTGGAGGACATTGAAAGCAAAATCCAACCAGGTTCTCAACAGGCTGACTTCCTGGATGCACTAATCGTGAGCATGGATGTGATTCAACATGAAACAATAGGAAAGAAGTTTGAGAAGAGGCATATTGAAATATTCACTGACCTCAGCAGCCGATTCAGCAAAAGTCAGCTGGATATTATAATTCATAGCTTGAAGAAATGTGACATCTCCCTGCAATTCTTCTTGCCTTTCTCACTTGGCAAGGAAGATGGAAGTGGGGACAGAGGAGATGGCCCCTTTCGCTTAGGTGGCCATGGGCCTTCCTTTCCACTAAAAGGAATTACCGAACAGCAAAAAGAAGGTCTTGAGATAGTGAAAATGGTGATGATATCTTTAGAAGGTGAAGATGGGTTGGATGAAATTTATTCATTCAGTGAGAGTCTGAGAAAACTGTGCGTCTTCAAGAAAATTGAGAGGCATTCCATTCACTGGCCCTGCCGACTGACCATTGGCTCCAATTTGTCTATAAGGATTGCAGCCTATAAATCGATTCTACAGGAGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCAAAAACCCTAAAAAAAGAAGATATACAAAAAGAAACAGTTTATTGCTTAAATGATGATGATGAAACTGAAGTTTTAAAAGAGGATATTATTCAAGGGTTCCGCTATGGAAGTGATATAGTTCCTTTCTCTAAAGTGGATGAGGAACAAATGAAATATAAATCGGAGGGGAAGTGCTTCTCTGTTTTGGGATTTTGTAAATCTTCTCAGGTTCAGAGAAGATTCTTCATGGGAAATCAAGTTCTAAAGGTCTTTGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTGTTTCCAACCACCAAAATCCCAAATCCTCGATTTCAGAGATTATTTCAGTGTCTGCTGCACAGAGCTTTACATCCCCGGGAGCCTCTACCCCCAATTCAGCAGCATATTTGGAATATGCTGAATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCTCTCTCTAAAATAAAGACCCTTTTTCCTCTGATTGAAGCCAAGAAAAAGGATCAAGTGACTGCTCAGGAAATTTTCCAAGACAACCATGAAGATGGACCTACAGCTAAAAAATTAAAGACTGAGCAAGGGGGAGCCCACTTCAGCGTCTCCAGTCTGGCTGAAGGCAGTGTCACCTCTGTTGGAAGTGTGAATCCTGCTGAAAACTTCCGTGTTCTAGTGAAACAGAAGAAGGCCAGCTTTGAGGAAGCGAGTAACCAGCTCATAAATCACATCGAACAGTTTTTGGATACTAATGAAACACCGTATTTTATGAAGAGCATAGACTGCATCCGAGCCTTCCGGGAAGAAGCCATTAAGTTTTCAGAAGAGCAGCGCTTTAACAACTTCCTGAAAGCCCTTCAAGAGAAAGTGGAAATTAAACAATTAAATCATTTCTGGGAAATTGTTGTCCAGGATGGAATTACTCTGATCACCAAAGAGGAAGCCTCTGGAAGTTCTGTCACAGCTGAGGAAGCCAAAAAGTTTCTGGCCCCCAAAGACAAACCAAGTGGAGACACAGCAGCTGTATTTGAAGAAGGTGGTGATGTGGACGATTTATTGGACATGATATAGGTCGTGGATGTATGGGGAATCTAAGAGAGCTGCCATCGCTGTGATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGCCATTCAAGGGGAGCCAAAATCTCAAGAAATTCCCAGCAGGTTACCTGGAGGCGGATCATCTAATTCTCTGTGGAATGAATACACACATATATATTACAAGGGATAATTTAGACCCCATACAAGTTTATAAAGAGTCATTGTTATTTTCTGGTTGGTGTATTATTTTTTCTGTGGTCTTACTGATCTTTGTATATTACATACATGCTTTGAAGTTTCTGGAAAGTAGATCTTTTCTTGACCTAGTATATCAGTGACAGTTGCAGCCCTTGTGATGTGATTAGTGTCTCATGTGGAACCATGGCATGGTTATTGATGAGTTTCTTAACCCTTTCCAGAGTCCTCCTTTGCCTGATCCTCCAACAGCTGTCACAACTTGTGTTGAGCAAGCAGTAGCATTTGCTTCCTCCCAACAAGCAGCTGGGTTAGGAAAACCATGGGTAAGGACGGACTCACTTCTCTTTTTAGTTGAGGCCTTCTAGTTACCACATTACTCTGCCTCTGTATATAGGTGGTTTTCTTTAAGTGGGGTGGGAAGGGGAGCACAATTTCCCTTCATACTCCTTTTAAGCAGTGAGTTATGGTGGTGGTCTCATGAAGAAAAGACCTTTTGGCCCAATCTCTGCCATATCAGTGAACCTTTAGAAACTCAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATATCACTTCACTGTTCTCTACTTGCAAGCCTCAAAGAGAGAAAGTTTCGTTATATTAAAACACTTAGGTAACTTTTCGGTCTTTCCCATTTCTACCTAAGTCAGCTTTCATCTTTGTGGATGGTGTCTCCTTTACTAAATAAGAAAATAACAAAGCCCTTATTCTCTTTTTTTCTTGTCCTCATTCTTGCCTTGAGTTCCAGTTCCTCTTTGGTGTACAGACTTCTTGGTACCCAGTCACCTCTGTCTTCAGCACCCTCATAAGTCGTCACTAATACACAGTTTTGTACATGTAACATTAAAGGCATAAATGACTCATC