Transcript asmbl_39057

Sequence
Transcript Sequence for observation asmbl_39057 of TGE0057387:
GCCAGCCCGCCCGCCCGCCCGCCAGCCAGCCCTCCCCGCGGCCGGCTCGGCTCCTTGGCGCTGCCTGGGGTCCTTTCCGCCCGGTCCCCGCTTGCCAGCCCCCGCTGCTCTGTGCCCTGTCCGGCCAGGCCTGGAGCCGACACCACCGCCATCATGCCGGCCGTGTCCAAGGGCGATGGGATGCGGGGGCTCGCGGTGTTCATCTCCGACATCCGGAACTGTAAGAGCAAAGAGGCGGAAATTAAGAGAATCAACAAGGAACTGGCCAACATCCGCTCCAAGTTCAAAGGAGACAAAGCCTTGGATGGCTACAGTAAGAAAAAATATGTGTGTAAACTGCTTTTCATCTTCCTGCTTGGCCATGACATTGACTTTGGGCACATGGAGGCTGTGAATCTGTTGAGTTCCAATAAATACACAGAGAAGCAAATAGGTTACCTGTTCATTTCTGTGCTGGTGAACTCGAACTCGGAGCTGATCCGCCTCATCAACAACGCCATCAAGAATGACCTGGCCAGCCGCAACCCCACCTTCATGTGCCTGGCCCTGCACTGCATCGCCAACGTGGGCAGCCGGGAGATGGGCGAGGCCTTTGCCGCTGACATCCCCCGCATCCTGGTGGCCGGGGACAGCATGGACAGTGTCAAGCAGAGTGCGGCCCTGTGCCTCCTTCGACTGTACAAGGCCTCGCCTGACCTGGTGCCCATGGGCGAGTGGACGGCGCGTGTGGTACACCTGCTCAATGACCAGCACATGGGTGTGGTCACGGCCGCCGTCAGCCTCATCACCTGTCTCTGCAAGAAGAACCCAGATGACTTCAAGACGTGCGTCTCTCTGGCTGTGTCGCGCCTGAGCCGGATCGTCTCCTCTGCCTCCACCGACCTCCAGGACTACACCTACTACTTCGTCCCAGCACCCTGGCTCTCGGTGAAGCTCCTGCGGCTGCTGCAGTGCTACCCGCCTCCAGAGGATGCGGCTGTGAAGGGGCGGCTGGTGGAATGTCTGGAGACTGTGCTCAACAAGGCCCAGGAGCCCCCCAAATCCAAGAAGGTGCAGCATTCCAACGCCAAGAACGCCATCCTCTTCGAGACCATCAGCCTCATCATCCACTATGACAGTGAGCCCAACCTCCTGGTTCGGGCCTGCAACCAGCTGGGCCAGTTCCTGCAGCACCGGGAGACCAACCTGCGCTACCTGGCCCTGGAGAGCATGTGCACGCTGGCCAGCTCCGAGTTCTCCCATGAAGCCGTCAAGACGCACATTGACACCGTCATCAATGCCCTCAAGACGGAGCGGGACGTCAGCGTGCGGCAGCGGGCGGCTGACCTCCTCTACGCCATGTGTGACCGGAGCAATGCCAAGCAGATCGTGTCGGAGATGCTGCGGTACCTGGAGACGGCAGACTACGCCATCCGCGAGGAGATCGTCCTGAAGGTGGCCATCCTGGCCGAGAAGTACGCCGTGGACTACAGCTGGTACGTGGACACCATCCTCAACCTCATCCGCATTGCGGGCGACTACGTGAGTGAGGAGGTGTGGTACCGTGTGCTACAGATCGTCACCAACCGTGATGACGTCCAGGGCTATGCCGCCAAGACCGTCTTTGAGGCGCTCCAGGCCCCTGCCTGTCACGAGAACATGGTGAAGGTTGGCGGCTACATCCTTGGGGAGTTTGGGAACCTGATTGCTGGGGACCCCCGCTCCAGCCCCCCAGTGCAGTTCTCCCTGCTCCACTCCAAGTTCCATCTGTGCAGCGTGGCCACGCGGGCGCTGCTGCTGTCCACCTACATCAAGTTCATCAACCTCTTCCCCGAGACCAAGGCCACCATCCAGGGCGTCCTGCGGGCCGGCTCCCAGCTGCGCAATGCTGACGTGGAGCTGCAGCAGCGAGCCGTGGAGTACCTCACCCTCAGCTCAGTGGCCAGCACCGACGTCCTGGCCACGGTGCTGGAGGAGATGCCGCCCTTCCCCGAGCGCGAGTCGTCCATCCTGGCCAAGCTGAAACGCAAGAAGGGGCCAGGGGCCGGCAGCGCCCTGGACGATGGCCGGAGGGACCCCAGCAGCAACGACATCAACGGGGGCATGGAGCCCACCCCCAGCACTGTGTCGACGCCCTCGCCCTCCGCCGACCTCCTGGGGCTGCGGGCAGCCCCTCCCCCGGCAGCACCCCCGGCTTCTGCAGGAGCAGGGAACCTTCTGGTGGACGTCTTCGATGGCCCGGCCGCCCAGCCCAGCCTGGGGCCCACCCCCGAGGAGGCCTTCCTCAGCCCAGGTCCTGAGGACATCGGCCCTCCCATTCCGGAAGCCGATGAGTTGCTGAATAAGTTTGTGTGTAAGAACAACGGGGTCCTGTTCGAGAACCAGCTGCTGCAGATCGGAGTCAAGTCAGAGTTCCGACAGAACCTGGGCCGCATGTATCTCTTCTATGGCAACAAGACCTCGGTGCAGTTCCAGAATTTCTCACCCACTGTGGTTCACCCGGGAGACCTCCAGACTCAGCTGGCTGTGCAGACCAAGCGCGTGGCGGCGCAGGTGGACGGCGGCGCGCAGGTGCAGCAGGTGCTCAATATCGAGTGCCTGCGGGACTTCCTGACGCCCCCGCTGCTGTCCGTGCGCTTCCGGTACGGTGGCGCCCCCCAGGCCCTCACCCTGAAGCTCCCAGTGACCATCAACAAGTTCTTCCAGCCCACCGAGATGGCGGCCCAGGATTTCTTCCAGCGCTGGAAGCAGCTGAGCCTCCCTCAACAGGAGGCGCAGAAAATCTTCAAAGCCAACCACCCCATGGACGCAGAAGTTACTAAGGCCAAGCTTCTGGGGTTTGGCTCTGCTCTCCTGGACAATGTGGACCCCAACCCTGAGAACTTCGTGGGGGCGGGGATCATCCAGACTAAAGCCCTGCAGGTGGGCTGTCTGCTTCGGCTGGAGCCCAATGCCCAGGCCCAGTTTAATCTCCTGTCTCCAACCTCTGGTGTTCCTCTCCTCTTCCTGTCCCTCCCTGATTTCTACCTTTCCATATCCTTTCCACCTTTCTCTCATCTTTTATAATTTTCTTCCTCTCTGGCGCCTCTGTTGATTTCAGTCTTACATTTTTCTCTCCTGTGTCTTGTATCACCTTTCTGGCCCCTTTATCCTTCCTTCCTTCTATCTCCCTTGGGTCCCGACTTCCCTGGGCTCCCCATCTCCTCTGAGTTCTGCCCCCAATGCCCCCACCCAGATGTACCGGCTGACCCTGCGCACCAGCAAGGAGCCCGTCTCCCGTCACCTGTGTGAGCTGCTGGCACAGCAGTTCTGAGCCCTGGACTCTGCCCCGGGGGATGTGGCCGGCACTGGGCAGCCCCTTGGACTGAGGCAGTTTTGGTGGATGGGGGACCTCCACTGGTGACAGAGAAGACACCAGGGTTTGGGGGATGCCTGGGACTTTCCTCCGGCCTTTTGTATTTTTATTTTTGTTCATCTGCTGCTGTTTACATTCTGGGGGGTTAGGGGGAGTCCCCCTCCCTCCCTTTCCCCCCCAAGCACAGAGGGGAGAGGGGCCAGGGAAGTGGATGTCTCCTCCCCTCCCACCCCACCCTGTTGTAGCCCCTCCTACCCCCTCCCCATCCAGGGGCTGTGTATTATTGTGAGCGAATAAACAGAGAGACGCTAAC