Transcript asmbl_38057

Sequence
Transcript Sequence for observation asmbl_38057 of TGE0001081:
TTTGTGAGTCTATAACTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTGTCCCAGATATAGCCGTTGGTACAAAGCGGGGATCTGACGAGCTTTTCTCTACTTGTGTCACTAACGGACCGTTTATCATGAGCAGCAACTCGGCTTCTGCAGCAAACGGAAATGACAGCAAGAAGTTCAAAGGTGACAGCCGAAGTGCAGGCGTCCCCTCTAGAGTGATCCACATCCGGAAGCTCCCCATCGACGTCACGGAGGGGGAAGTCATCTCCCTGGGGCTGCCCTTTGGGAAGGTCACCAACCTCCTGATGCTGAAGGGGAAAAACCAGGCCTTCATCGAGATGAACACGGAGGAGGCTGCCAACACCATGGTGAACTACTACACCTCGGTGACCCCTGTGCTGCGCGGCCAGCCCATCTACATCCAGTTCTCCAACCACAAGGAGCTGAAGACCGACAGCTCTCCCAACCAGGCGCGGGCCCAGGCGGCCCTGCAGGCGGTGAACTCGGTCCAGTCGGGGAACCTGGCCTTGGCTGCCTCGGCGGCGGCCGTGGACGCAGGGATGGCGATGGCCGGGCAGAGCCCCGTGCTCAGGATCATCGTGGAGAACCTCTTCTACCCTGTGACCCTGGATGTGCTGCACCAGATTTTCTCCAAGTTCGGCACAGTGTTGAAGATCATCACCTTCACCAAGAACAACCAGTTCCAGGCCCTGCTGCAGTATGCGGACCCCGTGAGCGCCCAGCACGCCAAGCTGTCGCTGGACGGGCAGAACATCTACAACGCCTGCTGCACGCTGCGCATCGACTTTTCCAAGCTCACCAGCCTCAACGTCAAGTACAACAATGACAAGAGCCGTGACTACACACGCCCAGACCTGCCTTCCGGGGACAGCCAGCCCTCGCTGGACCAGACCATGGCCGCGGCCTTCGGTGCACCTGGTATAATCTCAGCCTCTCCGTATGCAGGAGCTGGTTTCCCTCCCACCTTTGCCATTCCTCAAGCTGCAGGCCTTTCCGTTCCGAACGTCCACGGCGCCCTGGCCCCCCTGGCCATCCCCTCGGCGGCGGCGGCAGCTGCGGCGGCAGGTCGGATCGCCATCCCGGGCCTGGCGGGGGCAGGAAATTCTGTATTGCTGGTCAGCAACCTCAACCCAGAGAGAGTCACACCCCAAAGCCTCTTTATTCTTTTCGGCGTCTACGGTGACGTGCAGCGCGTGAAGATCCTGTTCAATAAGAAGGAGAACGCCCTAGTGCAGATGGCGGACGGCAACCAGGCCCAGCTGGCCATGAGCCACCTGAACGGGCACAAGCTGCACGGGAAGCCCATCCGCATCACGCTCTCGAAGCACCAGAACGTGCAGCTGCCCCGCGAGGGCCAGGAGGACCAGGGCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGGAGGCGGTCCAGGCCCTCATTGACCTGCACAACCACGACCTCGGGGAGAACCACCACCTGCGGGTCTCCTTCTCCAAGTCCACCATCTAGGGGCACAGGCCCCCACGGCCGGGCCCCCTGGCGACAACTTCCATCATTCCAGAGAAAAGCCACTTTAAAAACAGCTGAAGTGACCTTAGCAGACCAGAGATTTTATTTTTTTAAAGAGAAATCAGTTTACCTGTTTTTAAAAAAATTAAATCTAGTTCACCTTGCTCACCCTGCGGTGACAGGGACAGCTCAGGCTCTTGGTGACTGTGGCAGCGGGAGTTCCCGGCCCTCCACACCCGGGGCCAGACCCTCGGGGCCATGCCTTGGTGGGGCCTGTGTCGGGCGTGGGGCCTGCAGGTGGGCGCCCCGACCACGACTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTGTAATCTAAACTTCCTTGTGGTATTACCTTGTATGCTGTTACTTTTATTTTATTCCTTGTAATTAAGTCACAGGCAGGACCCAGTTTCCAGAGAGCAGGCGGGGCCGCCCAGTGGGTCAGGCACAGGGAGCCCCGGTCCTATCTTAGAGCCCCTGAGCTTCAGGGAAGGGGCGGGCGTGTCGCCGCCTCTGGCATCGCCTCCGGTTGCCTTACACCACGCCTTCACCTGCAGTCGCCTAGAAAACTTGCTCTCAAACTTCAGGGTTTTTTCTTCCTTCAAATTTTGGACCAAAGTCTCATTTCTGTGTTTTGCCTGCCTCTGATGCTGGGACCCGGAAGGCGGGCGCTCCTCCTGTCTTCTCTGTGCTCTTTCTACCGCCCCCGCGTCCTGTCCCGGGGGCTCTCCTAGGATCCCCTTTCCGTAAAAGCGTGTAACAAGGGTGTAAATATTTATAATTTTTTATACCTGTTGTGAGACCCGAGGGGCGGCGGCGCGGTTTTTTATGGTGACACAAATGTATATTTTGCTAACAGCAATTCCAGGCTCAGTATTGTGACCGCGGAGCCACAGGGGACCCCACGCACATTCCGTTGCCTTACCCGATGGCTTGTGACGCGGAGAGAACCGATTAAAACCGTTTGAGAAACTCCTCCCTTGTCTAGCCCTGTGTTCGCTGTGGACGCTGTAGAGGCAGGTTGGCCAGTCTGTACCTGGACTTCGAATAAATCTTCTGTATCCTCGCTCC