Transcript asmbl_37597

Sequence
Transcript Sequence for observation asmbl_37597 of TGE0001056:
CATTCTTCAAGAAACGGTTTGAATCAGACTGCCTTTCCTTTTGTCTTCATTGTCATAAACATCTGCCCCCGTGTGGTTCTGACTGGCCGCGAACCCCTACCCGAAGCTTTTATTCCATCATTGTGCACCGTTGGTGGGGAATGCTGTGGCAACAGGCCACGCCTCCACTTACTGGTTGGCTTTGCGCAGGCGCCAACGGAAGTGGGTCGCAGGAAGAGGAAGTCCCGCCTCTCTCTCCTCAGGCAGCAGCAACGCGGAGGAAACGGGAGTGAACGGAGAGCGTAGTGACCATCATGAGCCTCCTCAACAAGCCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGAGAGGAGGAGGAATTTAACACCGGTCCACTCTCTGTGCTCACACAGTCAGTCAAGAACAATACCCAAGTGCTCATCAACTGCCGCAACAATAAGAAACTCCTGGGCCGCGTGAAGGCCTTCGATAGGCACTGCAACATGGTGCTGGAGAACGTGAAGGAGATGTGGACTGAGGTACCCAAGAGTGGCAAGGGCAAGAAGAAGTCCAAGCCAGTCAACAAAGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCAGTCATCGTGGTCCTGCGGAACCCGCTCATCGCCGGCAAGTAGGGGCCGCCTGTCTGTTGACAGAACTCACTCCTCTGTCCTATGAAGACCGCTGCCATTGGTGTTGAGAATAATAAAGCTCTGTGTTTTTTTCTA