Transcript asmbl_36851

Sequence
Transcript Sequence for observation asmbl_36851 of TGE0001003:
GAAGGAGGAGCTGCGCGAGCTCAACGACCGCCTGGCGCACTACATCGACCGCGTCCGCGCGCTGGAGCTGGAGAACGACCGGCTCCTGCTCAAGATCTCAGAGAAGGAGGAGGTGACCACGCGCGAGGTGAGTGGCATCAAGGCGCTGTACGAGTCGGAGCTGGCCGATGCCCGGAGAGTCCTGGATGAGACGGCTCGAGAGCGTGCCCGGCTGCAGATAGAGATTGGGAAGCTGAGGGCAGAGTTGGACGAGGTCAACAAGAGCGCCAAGAAGAGGGAGGGCGAGCTTACGGTGGCCCAGGGCCGTGTGAAGGACCTGGAGTCCCTGTTCCACCGGAGCGAGGTGGAGCTGGCAGCTGCCCTCAGCGACAAGCGCGGCCTGGAGAGTGACGTGGCTGAGCTGCGGGCCCAGCTGGCCAAGGCCGAGGACGGTCATGCAGTGGCCAAAAAGCAGCTGGAGAAGGAGACGCTGATGCGTGTGGACCTGGAGAACCGCTGCCAGAGCCTGCAGGAGGAGCTGGACTTCCGGAAGAGTGTGTTCGAGGAGGAGGTGCGGGAGACGCGGCGGCGGCACGAGCGGCGCCTGGTGGAGGTGGACAGCAGCCGGCAGCAGGAGTACGACTTCAAGATGGCACAGGCGCTGGAGGAGCTGCGGAGCCAGCACGACGAGCAAGTGCGGCTCTACAAGCTGGAGCTGGAGCAGACCTACCAGGCCAAGCTGGACAGCGCCAAGCTGAGCTCTGACCAGAACGACAAGGCGGCCAGTGCGGCTCGCGAGGAGCTGAAGGAGGCCCGCATGCGCCTGGAGTCCCTCAGCTACCAGCTCTCCGGCCTCCAGAAGCAGGCCAGTGCCGCTGAAGATCGCATTCGGGAGCTGGAGGAGGCCATGGCCGGGGAGCGGGACAAGTTCCGGAAGATGCTGGACGCCAAGGAGCAGGAGATGACGGAGATGCGGGACGTGATGCAGCAGCAGCTGGCCGAGTACCAGGAGCTGCTGGACGTGAAGCTGGCCCTGGACATGGAGATCAACGCCTACCGGAAGCTCCTGGAGGGCGAGGAGGAGAGGCTGAAGCTGTCCCCCAGCCCATCCTCGCGCGTCACCGTCTCACGAGCCACCTCGAGCAGCAGCGGCAGCTTGTCCGCCACCGGGCGCCTGGGCCGCAGTAAGCGGAAGCGGCTGGAGGTGGAGGAGCCCTTGGGCAGCGGCCCAAGCGTCCTGGGCACGGGCACGGGTGGCAGCGGTGGCTTCCACCTGGCCCAGCAGGCCTCGGCCTCGGGTAGCGTCAGCATCGAGGAGATCGACCTGGAGGGCAAGTTTGTGCAGCTCAAGAACAACTCGGACAAGGATCAGTCTCTGGGGAACTGGAGAATCAAGAGGCAGGTCTTGGAGGGGGAGGAGATCGCCTACAAGTTCACGCCCAAGTACATCCTGCGCGCCGGCCAGATGGTCACGGTGTGGGCAGCTGGTGCGGGGGTGGCCCACAGCCCCCCCTCGACGCTGGTGTGGAAGGGCCAGAGCAGCTGGGGCACGGGCGAGAGCTTCCGCACCGTCCTGGTTAACGCGGATGGCGAGGAAGTGGCCATGAGGACTGTGAAGAAGTCCTCGGTGATGCGTGAGAATGAGAATGGGGAGGAAGAGGAGGAGGAAGCCGAGTTTGGCGAGGAGGATCTTTTCCACCAACAGGGGGACCCGAGGACCACCTCAAGAGGCTGCTACGTGATGTGAACCCACACTCCTCATCCACACACCTTTCTTTACCCAGAGCCACTGAAAACTATTTTTATATCATTGGCTTTCTTTAGTTCTTGATACATTTCTAGAGAATTTCTAAGCGAACTGCCAGAACGTGTGGGTGGGTCTCCCCCAGCCCTCCCTCCTGGCGGGTCTCCTCCAGCCTCACTTCGCTGCCACTTCGCCGCTGCCCCGGAGACTTTTCAATCCCACCCCACTCCTCATCTCACCATTTGGTCAAATTGGAAGCCCAGGGCCAGGACCCGGAGGTTTAGAAGATGCTTGGGCTTGGAGGGAGGAGGGCCGGCGAGGCTAGCGAGGGGACAGGAGACGGCCCTGCTGCGGACGGAGCGCGGAAACTGCGTAGGAATTCAGTGGTGGTGGGTTTTTTTAAGGCTTTCTACAAAACCAAATTCAGAATCCAGGCGTCGACCTGGTGGGGCCCGGGGCCAAGCCTGCATTCTGGCTGCCCAGCTTCGGACAGCGGGAACTCCTCAGGCAGCCACGCAGCGGGTGTGGGCCAGCATGGGGATGGCGTGGCCCCCAGGGCGGGTTTTCACTCCGCTGCCTGGGCTTCCAGATTCCCGTTCTGGCAGCGCACCGGCCGGGTTTCTCGGACCGTTGACTTTATTTGGGGGAGTTTTCCCGCAGTTCAGTTCCTGACTGTGCAAGGCCAACAGGGCAGGGGAGGG