Transcript asmbl_11112

Sequence
Transcript Sequence for observation asmbl_11112 of TGE0000085:
GGTGGTGCTGGGGAACTTGGCCGAGAGGGGGAAGGGCTCTGCGGGGCTGGGAGGGGCTGCGTGAGAGGCTCGAGAACGTCGCACCTCGTCTGGGCCCCCCGCCAGATTGAGGCCGGCGCTGCAGGCAGCGGCGGCTGCGCGGTGAACGAGGCGGCCTGCGCGGCGGAGTGCTGAGTCCCGATCCCCGGCTCTGTCCGGCCCACGGATCCTCAAGCCCGGGCCCCGGGCCCGGCCCCAGCCTCAGCCCTGAGCGTCTCGGGGCGGATGGCGCGGGGCGGCGGGGGCGGGCGGTGCTGAGCCCTGCGCGGGCCATGGCCTCGGCCTGCGGGGCGCCGGGCCCGGGGGGCGCCCTGGGCAGCCAGGCCCCCTCCTGGTACCACCGCGACCTGAGCCGGGCGGCCGCGGAGGAGCTGCTGGCCCGGGCGGGCCGCGATGGCAGCTTCCTGGTCCGAGACAGCGAGAGCGTGGCGGGGGCCTTCGCGCTCTGCGTCCTGTATCAGAAGCATGTGCACACGTATCGCATTCTGCCTGATGGAGAAGATTTCTTGGCTGTGCAGACCTCGCAGGGTGTGCCTGTGCGCCGCTTCCAGACCCTGGGTGAGCTCATCGGCCTGTACGCCCAGCCCAACCAGGGCCTTGTGTGCGCCCTGCTTCTTCCTGTAGAGGGTGAGCGAGAGCCGGACCCACCGGATGACCGGGATGCCTCAGATGGGGAGGATGAGAAGCCCCCGCTGCCCCCGCGCTCTGGCTCCACCAGCATTTCTGCCCCCACTGGGCCCAGCAGTCCCCTGCCAGCTCCTGAGACTCCCACAGCTCCAGCTGCTGAGAGGGATGGGGCAGAGGTGCTGGGACAGGTCAGCAGGACCTCCACTGACTTCTTAACCCCTCCCCAAAGTGCTCCCAATGGGCTGAGCACCGTCTCGCACGACTACCTGAAAGGCAGCTATGGGCTGGACCTGGAAGCTGTGAGGGGTGGAGCCAGCCACCTGCCCCACCTCACCCGTACCCTCGCTACCTCATGCCGGAGGCTGCACAGTGAGGTGGACAAGGTCCTGTCAGGCCTGGAGATCCTGTCCAAGGTGTTTGACCAGCAGAGCTCGCCCATGGTGACCCGCCTTTTGCAGCAGCAGAACCTGCCACAGACAGGGGAGCAGGAACTAGAGAGCCTGGTGCTGAAGCTGTCAGTGCTAAAGGACTTCCTGTCAGGCATCCAGAAGAAGGCCCTGAAGGCCCTACAGGACATGAGCTCCACAGCACCCCCAGCTCCGCAGCCATCCACACGTAAGGCCAAGACCATCCCCGTGCAGGCCTTTGAGGTGAAGCTAGATGTGACCCTGGGTGACCTGACCAAGATTGGGAAGTCACAGAAGTTCACGCTGAGCGTGGATGTGGAGGGTGGGCGGCTGGTGCTGCTGCGGAGACAGCGGGACTCCCAGGAGGACTGGACCACCTTCACGCACGACCGCATCCGCCAGCTCATTAAGTCCCAGCGTGTCCAGAACAAGCTGGGTGTTGTGTTTGAGAAGGAGAAGGACCGGACTCAGCGCAAGGACTTCATCTTTGTCAGTGCCCGGAAGCGGGAGGCCTTCTGCCAGCTGTTGCAGCTCATGAAGAACAAGCACTCCAAGCAGGACGAGCCCGACATGATCTCAGTCTTCATAGGCACCTGGAACATGGGAAGTGTACCACCTCCAAAAAACGTGACATCCTGGTTCACATCGAAGGGTCTGGGGAAGACCCTGGACGAGGTCACAGTGACCATACCCCATGACATCTATGTCTTTGGGACCCAGGAGAACTCAGTGGGCGACCGCGAGTGGCTGGACCTACTGCGCGGGGGCCTCAAGGAGCTTACGGATCTGGATTACCGCCCGATTGCCATGCAATCACTGTGGAATATCAAGGTGGCAGTGCTGGTCAAGCCAGAGCACGAGAACCGTATCAGCCATGTCAGTACGTCCAGTGTGAAGACTGGCATCGCCAACACCCTGGGGAACAAGGGGGCTGTGGGCGTCTCCTTCATGTTTAATGGCACCTCATTTGGCTTTGTGAATTGTCACCTCACCTCGGGAAATGAGAAGACGGCTCGGAGGAACCAAAACTACTTGGACATCCTGCGGCTGCTCTCGCTGGGCGACCGGCAGCTCAATGCCTTTGACATCTCTCTGCGTTTCACACACCTCTTCTGGTTTGGGGACCTCAACTACCGCCTGGACATGGATATCCAGGAGATCCTGAACTACATCAGCAGGAAAGAGTTTGAGCCCCTCCTCAGGGTGGACCAGCTCAACCTGGAGCGGGAGAAGCACAAGGTCTTCCTTCGATTCAGTGAGGAGGAGATCTCCTTCCCACCCACCTACCGCTATGAGCGGGGTTCCCGGGACACATATGCCTGGCACAAGCAGAAGCCAACTGGGGTCCGGACCAATGTGCCCTCATGGTGTGACCGGATTCTGTGGAAATCCTACCCTGAAACTCACATCATCTGCAATTCTTATGGTTGCACTGATGACATCGTCACCAGCGACCATTCCCCCGTGTTTGGGACATTTGAGGTTGGAGTTACCTCCCAGTTCATCTCCAAGAAAGGGCTCTCAAAGACTTCAGACCAGGCCTACATTGAGTTTGAGAGCATCGAGGCCATTGTGAAGACAGCCAGCCGCACCAAGTTCTTCATCGAGTTCTACTCTACCTGCCTGGAGGAATACAAGAAGAGCTTTGAGAATGATGCCCAGAGCAGTGACAACATCAACTTCCTCAAAGTGCAGTGGTCTTCACGCCAGCTGCCCACGCTCAAACCAATTCTGGCTGATATCGAGTACCTGCAGGACCAGCACCTCCTGCTCACAGTCAAGTCCATGGATGGCTATGAATCCTATGGGGAGTGTGTGGTTGCACTCAAATCCATGATCGGCAGCACGGCCCAACAGTTCCTGACCTTCCTATCCCACCGTGGCGAGGAGACAGGCAATATCAGAGGCTCCATGAAGGTGCGGGTGCCCACGGAGCGCCTGGGCACCCGTGAGCGGCTCTACGAGTGGATCAGCATTGATAAGGATGAGGCAGGAGCAAAGAGCAAAGCCCCCTCTGTGTCCCGAGGGAGCCAGGAGCCCAGGTCAGGGAGCCGCAAGCCAGCCTTCACAGAGGCCTCCTGCCCGCTCTCCAGGTTATTTGAAGAACCAGAGAAACCGCCACCAACGGGGAGGCCCCCAGCCCCACCCCGAGCAGCTCCCCGGGAGGAGCCCTTGACCCCCAGGTTGAAGCCAGAGGGAGCTCCTGAACCAGAAGGGGTGGCGGCCCCCCCACCCAAGAACAGCTTCAATAACCCTGCCTACTACGTCCTTGAAGGGGTCCCGCACCAGCTGCTGCCCCCGGAGCCACCCTCGCCTGCCAGGGCCCCTGTCCCATCTGCCACCAAGAACAAAGTGGCCATTACAGTGCCTGCTCCACAGCTTGGGCACCACCGGCACCCTCGTGTGGGAGAGGGGAGTTCTTCAGATGAGGAGTCTGGAGGCACACTGCCCCCTCCAGACTTTCCACCTCCACCACTGCCGGACTCAGCCATCTTCCTGCCCCCCAGCCTGGATCCTTTACCAGGGCCAGTGGTCCGGGGCCGTGGTGGGGCTGAGGCCCGTGGCCCACCACCTCCCAAGGCCCATCCAAGGCCTCCACTGCCCCCAGGCCCCTCACCAGCCAGCACTTTCCTGGGGGAAGTGGCCAGTGGGGATGACCGGTCCTGCTCGGTGCTGCAGATGGCCAAGACGCTGAGCGAGGTGGACTATGCCCCTGCTGGGCCTGCACGCTCAGCGCTCCTCCCAGGCCCCCTGGAGCTGCAGCCCCCCCGGGGACTGCCCTCGGACTATGGCCGGCCCCTCAGCTTCCCTCCACCCCGCATCCGGGAGAGCATCCAGGAAGACCTGGCAGAGGAGGCTCCGTGCCTGCAGGGCGGGCGGGCCAGCGGGCTGGGCGAGGCAGGCATGAGTGCCTGGCTGCGGGCCATCGGCTTGGAGCGCTATGAGGAGGGCCTGGTGCATAATGGCTGGGACGACCTGGAGTTTCTCAGTGACATCACCGAGGAGGACTTGGAGGAGGCTGGGGTGCAGGACCCGGCTCACAAGCGCCTCCTTCTGGACACCCTGCAGCTCAGCAAGTGATAGCGGAGGCACCACGAAGCTGTGAACTCAGAGCCCCTCCCTGCTACCAAGGCCCAGCTATGGCCCCAGGGTTGAAAAGTTATGAGGGTCAGGGCAGTATCTCTCTGCCTATTTATTGGGGTGCCTATTTATTGGGGATCTGCATTCCCCGCTGCCCAATCATTTGCAATGCCCTAATTAGGGCATCCTGCCCCTCGCCTTTTAGGCTCAGGACGGAAGGTCAGTTGCCATGGTTACCGAGGACCCTGGTTACTCTGGTGCTGTCCTGTTTTACTGGACCCCGCCTCCCAGCCCCAGGGGTGCCTGTGGGGGTCCATTTGGGTACGTCTGGGCCCCCACTTTCACCAGTTTCTGCGGCCTTCCACCGGGCCTGAACCACAGCGGAGGAGCTCCGCTAAGACCTCCCCACCCCCGCTGGGGGTGGGGGCGGGTGTCCGTCCGGAAATGAAGGAATAGCCCGAGGACCGGGCTGGGGTTTATTTAAACTGTTCTGTGTGGGTCTGGGGAGGGAGAGCACCTTAATATTATTGGGGTTGGTTGGGGTGGGGCAGGATCTCAGCCATAAAGTGCCAGTTTGCTTAGTTCTCACTGTCTCCTGGTCTGTGCTGCCCTGCTCTGGGGATGCACGGCGGCAGGGTGGGGGAGGGAGGTTCCTCGCAGGTCTCAGCCCGGGACAGGGTCTTGCAAGCAGCCTCCTGGGCAGTCGTAAGGGTTGCGGCGTGATGTCTTCAATAAATTAAGTTTTATTTGGATTGAGTAAAACTTCAATAA