Transcript asmbl_36670

Sequence
Transcript Sequence for observation asmbl_36670 of TGE0000988:
GCCTGAGGTGAGTGTTTCTCCTGCGTTGCTCCGAGGGCCCAATCCTCCTGCCATCGCCGCCATCCTGGCTTCGGGGGCGCCGGCCTCCAGGCCCCCGGGAGGAGAACTCCTAGGGCTACTAAATCCTCGCTGGAGGCGGTGGCTTCTTATGCGGGAGGACGTGGCGGAGGGCCTGACTTTGGGAGCCGGGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGGAAAAGAATGTTGGTTGTCTTTATTAGTGAAC