Transcript asmbl_36666

Sequence
Transcript Sequence for observation asmbl_36666 of TGE0000988:
AGGGTTGACTGGATTGGTGAGGCCCGTGTGGCTACTTCTGTGGAAGCAGTGCTGTAGTTACTGGAAGATAAAAGGGAAAGCAAGCCCTTGGTGGGGGAAAGTATGGCTGCGATGATGGCATTTCTTAGGACACCTTTGGATTAATAATGAAAACAACTACTCTCTGAGCAGCTGTTCGAATCATCTGATATTTATACTGAATGAGTTACTGTAAGTACGTATTGACAGAATTACACTGTACTTTCCTCTAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGGAAAAGAATGTTGGTTGTCTTTATTAGTGAAC