Transcript asmbl_20187

Sequence
Transcript Sequence for observation asmbl_20187 of TGE0004071:
CCGGCGCCGAGTCAGCTGGTTTTGGAATTGCGCTGCGTGCCTGCGGGTTGGGGTTCTCTGGTCCCGCCGGCCCCGCCGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTCAACGTGGACAATGGCTACTTGGAGGGACTGGTGCGCGGCCTAAAGGCTGGTGTGCTCAGCCAAGCCGACTACCTCAATTTGGTGCAGTGCGAGACGCTCGAGGACCTGAAGCTGCACCTGCAGAGCACTGACTACGGTAACTTCCTTGCCAATGAGGCATCACCACTGACAGTGTCAGTCATCGATGACCGGCTCAAGGAGAAGATGGTGGTAGAGTTCCGCCACATGAGGAACCATGCCTACGAGCCACTCGCCAGCTTCCTGGACTTTATTACTTACAGCTACATGATTGACAACGTGATCCTACTCATCACGGGCACGCTGCACCAGCGCTCTATCGCCGAGCTTGTGCCCAAGTGCCACCCACTAGGCAGCTTTGAGCAGATGGAGGCCGTGAACATTGCGCAGACACCTGCTGAGCTCTACAATGCTATTCTGGTGGACACACCCCTGGCGGCTTTTTTCCAGGACTGCATCTCAGAGCAGGACCTCGATGAGATGAACATTGAGATCATCCGCAATACGCTCTACAAGGCCTACCTGGAATCCTTCTACAAGTTCTGCACCCTACTGGGCGGGACCACAGCTGATGCCATGTGCCCCATCCTGGAGTTTGAAGCAGACCGCCGCGCCTTCATCATCACCATCAACTCCTTTGGCACAGAACTGTCTAAAGAGGATCGTGCAAAGCTCTTTCCACACTGTGGGCGGCTCTACCCAGAGGGCCTGGCCCAGCTGGCTCGGGCTGATGACTACGAACAAGTCAAGAACGTGGCTGACTACTACCCGGTGAGTGCCCTGGCTACAGGACAGTGGGTGAGCGTATTGGCACCTACATACCCACACCCAACAATGCCCTTATGCTCATGCTTCCCACCACTCCCCTGGGCCAGGAGTATAAGCTGCTCTTTGAAGGAGCAGGGAGCAACCCCGGAGACAAGACCCTGGAGGACCGATTCTTTGAGCATGAGGTGAAACTGAACAAGTTGGCCTTCCTGAACCAGTTTCACTTTGGTGTCTTTTACGCCTTTGTGAAGCTCAAGGAGCAGGAGTGTCGCAACATTGTATGGATTGCCGAGTGCATTGCCCAGCGTCACCGCGCCAAGATCGACAACTATATCCCCATCTTCTAGTGCCCTGGCCCAAGGCTCCCCATAAGTGTGTGTGTGTCTGTGCTGTGACCGAGGCTCCAGCTCACCTGCCTGTTCTGGGGGTAGCACATTGTCTTAGTGGCTGCCCAGTTTCCCTGACACTCTGCTCTTGGGCCTGAAAAGAGGCTGAGTACCTGTTCTCCCCACCAAGGATGGATGGACCAAGGCCCCACCTCCAGATCAAGGAGGCCCCTCAGTCCTGTTTACAGCCACTGACATGTCTGAGAAGCATGTGGTCACTTTTGTGTCCTTCCCTAACCTGAGAATCACTGGGGGCAACATGAGCCTCCTCTCTCCTTTATGGGTCAACCCCAGAGACATGGCCCAGGGGAAGGATAGTGTGTGTCTTTGAGGCATGGGGGTGCATCCCCCTCCTTCAGCTCTGCCCTTCAACAATAAACTGCCCTCTCCAAA