Transcript asmbl_34092

Sequence
Transcript Sequence for observation asmbl_34092 of TGE0000843:
GGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAG