Transcript asmbl_33259

Sequence
Transcript Sequence for observation asmbl_33259 of TGE0056256:
CCACCCTTAGTCCCAGGCATCTGACTACCGGGAACCTCAGCCAGAGTCCGGGAGCCCCCCACCCCGTCCAGGAGCCAACAGAGCCCCCGTCTTGCTGGCGTGAGAATACATTGCTCTCCTTTGGTTGAATCAGCTGTCCCTCTTCGTGGGAAAATGAACCAGAAGACAATCCTCGTGCTCCTCATTCTGGCCGTCATCACCATCTTTGCCTTGGTTTGTGTCCTGCTGGTGGGCAGGGGTGGAGATGGGGGTGAACCCAGCCAGCTTCCCCATTGCCCCTCTGTATCTCCCAGTGCCCAGCCTTGGACACACCCTGGCCAGAGCCAGCTGTTTGCAGACCTGAGCCGAGAGGAGCTGACGGCTGTGATGCGCTTTCTGACCCAGCGGCTGGGGCCAGGGCTGGTGGATGCAGCCCAGGCCCGGCCCTCGGACAACTGTGTCTTCTCAGTGGAGTTGCAGCTGCCTCCCAAGGCTGCAGCCCTGGCTCACTTGGACAGGGGGAGCCCCCCACCTGCCCGGGAGGCACTGGCCATCGTCTTCTTTGGCAGGCAACCCCAGCCCAACGTGAGTGAGCTGGTGGTGGGGCCACTGCCTCACCCCTCCTACATGCGGGACGTGACTGTGGAGCGTCATGGAGGCCCCCTGCCCTATCACCGACGCCCCGTGCTGTTCCAAGAGTACCTGGACATAGACCAGATGATCTTCAACAGAGAGCTGCCCCAGGCTTCTGGGCTTCTCCACCACTGTTGCTTCTACAAGCACCGGGGACGGAACCTGGTGACAATGACCACGGCTCCCCGTGGTCTGCAATCAGGGGACCGGGCCACCTGGTTTGGCCTCTACTACAACATCTCGGGCGCTGGGTTCTTCCTGCACCACGTGGGCTTGGAGCTGCTAGTGAACCACAAGGCCCTTGACCCTGCCCGCTGGACTATCCAGAAGGTGTTCTATCAAGGCCGCTACTACGACAGCCTGGCCCAGCTGGAGGCCCAGTTTGAGGCCGGCCTGGTGAATGTGGTGCTGATCCCAGACAATGGCACAGGTGGGTCCTGGTCCCTGAAGTCCCCTGTGCCCCCGGGTCCAGCTCCCCCTCTACAGTTCTATCCCCAAGGCCCCCGCTTCAGTGTCCAGGGAAGTCGAGTGGCCTCCTCACTGTGGACTTTCTCCTTTGGCCTCGGAGCATTCAGTGGCCCAAGGATCTTTGACGTTCGCTTCCAAGGAGAAAGACTAGTTTATGAGATAAGCCTCCAAGAGGCCTTGGCCATCTATGGTGGAAATTCCCCAGCAGCAATGACGACCCGCTATGTGGATGGAGGCTTTGGCATGGGCAAGTACACCACGCCCCTGACCCGTGGGGTGGACTGCCCCTACTTGGCCACCTACGTGGACTGGCACTTCCTTTTGGAGTCCCAGGCCCCCAAGACAATACGTGATGCCTTTTGTGTGTTTGAACAGAACCAGGGCCTCCCCCTGCGGCGACACCACTCAGATCTCTACTCGCACTACTTTGGGGGTCTTGCGGAAACGGTGCTGGTCGTCAGATCTATGTCCACCTTGCTCAACTATGACTATGTGTGGGATACGGTCTTCCACCCCAGTGGGGCCATAGAAATACGATTCTATGCCACGGGCTACATCAGCTCGGCATTCCTCTTTGGTGCTACTGGGAAGTACGGGAACCAAGTGTCAGAGCACACCCTGGGCACGGTCCACACCCACAGCGCCCACTTCAAGGTGGATCTGGATGTAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAGGCGGTCCTGGGATGGGGCATGTGGCCAAGGGCTCCAGGGCCAGGGTGTGAGGGATGGGGAGCAGCTGGGCACTGGGCCGGCAGCCTGGTTCCCTCTTTCCTGTGCCAGGACTCTCTTTCTTCCACTACCCTCCCTCGCATCCGCCTCTGAGCCAGGAGCCTCCTGACCCTGTGATGCCTGACACAGGGGACACTGAACCTTGTTGATGCCAGCTGTACTGAGTTCTCATCCACAGAGGCCAGGCATGGCCCAGCCTGGAGCCGTGGCCGAGGGCTTCCCTAGATGGTTCCCTTTGTTGCTGTCTGGCTTTCCCGAATCTTTTTAGGCCACCTCCAAGGACTCTAAAAGGGGGCTATTCCCTGGAGACCCCAGAGTAGGGTTGCCAGTCCTGCAAGTCCATAGCTGAGCTGGAAAGGATGCTTCTGCTCACATTCCCTCTCATCCAGGTCCTTTCCTTCTCGTCTTCCTCTCTCTCACCTACTTCCTCCTCCTCCTCCTGTTCCTGCCTTCTCTTCTATCCTGCAATTTCTCCCGAATCCTGAGGGGATATCCCTATGTCCCAGCCCCTGGTACTCCCCCAGCCCTCAGTTTTCAGTCAAGTTCCGTCTCCTCTCCAGCCCTATGGAAGTCTCAAGGTCACGGGACCCCTAATCAGAGTGGCCAATCCCTGTGTGTCGTTCCCTTGTGTCTGTTGCTTATTGGGAGTAGGAGTTGCTCCTACCCCTGTCCTGGGGCTGGGTGTGTTTCAGGACAGCTGCTTCTGTGCATTTGTGTCTGCCTGCCTCATGCTCTCTATAGAGGAGGATGGTCATCGTGACAGCAGCAGCTCAAGTTAGCATTTCAAGTGATTTGGGGGTGCAATGATAATGAAGAATGGCCATTTTGTACCAGGGCTCTGTATTCTGCAACAGCCTGTTTGGGAGGCTGGAGTGGAAACAAAGGGTGGGCATCAAAGATGAGAAGCCAAAGCCCCTACAACTCCAGCCACCCAGCCAGGAGGGGCTGTCCAATCACATTCAGGCATGCGAATGAGCTGGGCCCTGGGTGAGGTGGGGGTCTGGCCTAGTGGGGAGGGGCCTGGCCTGGGTGGGGCAGGGCCTGGCCTGGTCCAGGCTTGGGCTCCATTCCCATCACTGCTGTCCCTCCTGAGGTCTGGATTGGGGATGGGGACAAAGAAATAGCAAGAGATGAGAAACAACAGAAACTTTTTTCTCTAAAGGACTGGTTAAATCAATTCTGATACAGCCTTACAATACAATAGTATGCAGCTAAAAAATAATTGTATGTCTTTATATACTAATATGTAATAATCTTCAGGTGAAAAAGGCAAGCCACAGAAATGTGTATAGCGCACTTCCCATTTGTGTTTCAGAAAGGAGTAGAATATAAACACATAATTGCTTATGTATGCCTATTCAGAATAAATGGGTAACACTGATTACTTTTGGGAGGGGAACCAGTAGGTTGAGGACAGGAGAGGGAAGGGTCTTAACACTTACACCCTTTTGTACATTTTGAATTTTGAACCATGTGACTGTATTACCTATTCAAAATAAACAATAAATGGGCCCAAACAGGAA