Transcript asmbl_32795

Sequence
Transcript Sequence for observation asmbl_32795 of TGE0057302:
AGTGCCTGGGGATGCCAGCAGAAGTCCTGGCAAGTCACAGGAAGATGCTGGCTGGGAAGTCAGGGCCTGCTGAGCGCTAAACCAGAACCCGAGCCTGGCAGGCTCTCAAAGACGGGATGCTTGTCGTCGAGTCTCATACGCTAACCTCTGCTCCGCCTCTTCTCAGAGCTGCGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAGTCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTTGGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCAGATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGTTATGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCACAGGCAAACCCATCAAGCTGACTCAGGTGGAACACCGGGCTGGCTTTGAGTGGAACGAGGATGGGGCGGGAACCACCCCCAGCCCAGGGCTGCAGCCTGCCCACCTCACCTTCCCGCTGGACTATCACCTTAACCAGCCTTTCATCTTCGTACTGAGGGACACAGACACAGGGGCCCTTCTCTTCATTGGCAAGATTCTGGACCCCAGGGGCCCCTAATATCCCAGTTTAATATTCCAATACCCTAGAAGAAAACCCGAGGGACAGCAGATTCCACAGGACACGAAGGCTGCCCCTGTAAGGTTTCAATGCATACAATAAAAGAGCTTTATCCCTAA