Transcript asmbl_25660

Sequence
Transcript Sequence for observation asmbl_25660 of TGE0000877:
CAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGCCCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTACTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCTGGATGAG