Transcript asmbl_27436

Sequence
Transcript Sequence for observation asmbl_27436 of TGE0000590:
CTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATGCTCCCCAGGTTCATCCTGTGTCGTCTCCCCCACCTACCAGTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGC