Transcript asmbl_27336

Sequence
Transcript Sequence for observation asmbl_27336 of TGE0000584:
GGGAAAGTGTTAGCGGGGAACGCTGGGAAACTCCCGGCCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAGCTACTAACCAGAGCCGGCTCTTTCTCGAGATTTTATTCCCTCAAAGTTGCCCCCAAAGTTAAAGCCACAGCTGCGCCTGCAGGAGCACCGCCACAACCTCAGGACCTTGAGTTTACCAAGTTACCAAATGGCTTGGTGATTGCTTCTTTGGAAAACTATTCTCCTGTATCAAGAATTGGTTTGTTCATTAAAGCAGGCAGTAGATATGAGGACTTCAGCAATTTAGGAACCACCCATTTGCTGCGTCTTACATCCAGTCTGACGACAAAAGGAGCTTCATCTTTCAAGATAACCCGTGGAATTGAAGCAGTTGGTGGCAAATTAAGTGTGACCGCAACAAGGGAAAACATGGCTTATACTGTGGAATGCCTGCGGGGTGATGTTGATATTCTAATGGAGTTCCTGCTCAATGTCACCACAGCACCAGAATTTCGTCGTTGGGAAGTAGCTGACCTTCAGCCTCAGCTAAAGATTGACAAAGCTGTGGCCTTTCAGAATCCGCAGACTCATGTCATTGAAAATTTGCATGCAGCAGCTTACCGGAATGCCTTGGCTAATCCCTTGTATTGTCCTGACTATAGGATTGGAAAAGTGACATCAGAGGAGTTACATTACTTCGTTCAGAACCATTTCACAAGTGCAAGAATGGCTTTGATTGGACTTGGTGTGAGTCATCCTGTTCTAAAGCAAGTTGCTGAACAGTTTCTCAACATGAGGGGTGGGCTTGGTTTATCTGGTGCAAAGGCCAACTACCGTGGAGGTGAAATCCGAGAACAGAATGGAGACAGTCTTGTCCATGCTGCTTTTGTAGCAGAAAGTGCTGTCGCGGGAAGTGCAGAGGCAAATGCATTTAGTGTTCTTCAGCATGTCCTCGGTGCTGGGCCACATGTCAAGAGGGGCAGCAACACCACCAGCCATCTGCACCAGGCTGTTGCCAAGGCAACTCAGCAGCCATTTGATGTTTCTGCATTTAATGCCAGTTACTCAGATTCTGGACTCTTTGGGATTTATACTATCTCCCAGGCCACAGCTGCTGGAGATGTTATCAAGGCTGCCTATAATCAAGTAAAAACAATAGCTCAAGGAAACCTTTCCAACACAGATGTCCAAGCTGCCAAGAACAAGCTGAAAGCTGGATACCTAATGTCAGTGGAGTCTTCTGAGTGTTTCCTGGAAGAAGTCGGGTCCCAGGCTCTAGTTGCTGGTTCTTACATGCCACCATCCACAGTCCTTCAGCAGATTGATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCAGAGCAGCAAACACATGAAAGTCAGAAGTCTCTAATATATCATTTGTCTTTTTTCCAGTGAGGTAAAATAAGGCATAAATGCAGGTAATTATTCCCAGCTGACCTAAAGTCAATAAAACATTCTGTTTAAGTGTTTTTCTTACGTTTTTCTCAATGAGTTAATCAACAAGTATTTATTATGTGCTGATATCTTTGTTTTAGATGCTTTAAAGGAGACAGGAATATAATTATTGAGTATAGAAGCATCAGAAACTATTAAAATTAAGGCTAAGTGGCTATCGGGGTAAATAGTGCCAGATTACTATTGGTGGCGTTTAAGATGAAAGCAAGTTCAAAATTTGTCATTTTGGGTGTCAACAGCTAAATGGTCTGGTTTTTACCCCTGTTTTGCCTTTTTTGCAATAAAATTATTTCC