Transcript asmbl_23669

Sequence
Transcript Sequence for observation asmbl_23669 of TGE0000444:
ACAGAGGGGGCGGGGAGAGGGTGGAGCGCGGGGAGCCAGGCGAGGGGCCGCGACGACGGGACTCCATTAGCCGCTCCGGCCACAGGCAGCGCTTCGCCAGCCGAGGAACCGGACGCGGACACCGCCGCCCCGCGAGCCTCCAGCCCCTCGCCTGTTGCCGCGCGAGTCCCGGGCCCGGAGCGCTAGGAGCGCGCGGAAGGAGCCATGGCTCTGGACGGGATAAGGATGCCAGATGGCTGCTACGCGGACGGGACGTGGGAACTGAGTGTCCATGTGACGGACCTGAACCGCGATGTCACCCTGAGAGTGACCGGCGAGGTGCACATTGGAGGCGTGATGCTTAAGCTGGTGGAGAAACTCGATGTAAAAAAAGATTGGTCTGACCATGCTCTCTGGTGGGAAAAGAAGAGAACTTGGCTTCTGAAGACACATTGGACCTTAGATAAGTATGGTATTCAGGCAGATGCTAAGCTTCAGTTCACCCCTCAGCACAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGTGAATTTCTCTGATAGAGTCTTCAAAGCTGTTTCTGACATCTGTAAGACTTTTAATATCAGACACCCCGAAGAACTTTCTCTCTTAAAGAAACCCAGAGATCCAACAAAGAAAAAAAAGAAGAAGCTAGATGACCAGTCTGAAGATGAGGCACTTGAATTAGAGGGGCCTCTTATCACTCCTGGATCAGGAAGTATATATTCAAGCCCAGGACTGTATAGTAAAACAATGACCCCCACTTATGATGCTCATGATGGAAGCCCCTTGTCACCAACTTCTGCTTGGTTTGGTGACAGTGCTTTGTCAGAAGGCAATCCTGGTATACTTGCTGTCAGTCAACCAATCACGTCACCAGAAATCTTGGCAAAAATGTTCAAGCCTCAAGCTCTTCTTGATAAAGCAAAAATCAACCAAGGATGGCTTGATTCCTCAAGATCTCTCATGGAACAAGATGTGAAGGAAAATGAGGCCTTGCTGCTCCGATTCAAGTATTACAGCTTTTTTGATTTGAATCCAAAGTATGATGCAATCAGAATCAATCAGCTTTACGAGCAGGCCAAATGGGCCATTCTCCTGGAAGAGATTGAATGCACAGAAGAAGAAATGATGATGTTTGCAGCCCTGCAGTATCATATCAATAAGCTGTCAATCATGACATCAGAGAATCATTTGAACAACAGTGACAAAGAAGTTGATGAAGTTGATGCTGCCCTTTCAGACCTGGAGATTACTCTGGAAGGGGGTAAAACGTCAACAATTTTGGGTGACATTACTTCCATTCCTGAACTTGCTGACTACATTAAAGTTTTCAAGCCAAAAAAGCTGACTCTGAAAGGTTACAAACAATATTGGTGCACCTTCAAAGACACATCCATTTCTTGTTATAAGAGCAAAGAAGAATCCAGTGGCACACCAGCTCATCAGATGAACCTCAGGGGATGTGAAGTTACCCCAGATGTAAACATTTCAGGCCAAAAATTTAACATTAAACTCCTGATTCCAGTTGCAGAAGGCATGAATGAAATCTGGCTTCGTTGTGACAATGAAAAACAGTATGCACACTGGATGGCAGCCTGCAGATTAGCCTCCAAAGGCAAGACCATGGCGGACAGTTCTTACAACTTAGAAGTTCAGAATATTCTTTCCTTTCTGAAGATGCAGCATTTAAACCCAGATCCTCAGTTAATACCAGAGCAGATCACGACTGATATAACTCCTGAATGTTTGGTGTCTCCCCGCTATCTAAAAAAGTATAAGAACAAGCAGATAACAGCGAGAATCTTGGAGGCCCATCAGAATGTAGCTCAGATGAGTCTAATTGAAGCCAAGATGAGATTTATTCAAGCTTGGCAGTCACTACCTGAATTTGGCATCACTCACTTCATTGCAAGGTTCCAAGGGGGCAAAAAAGAAGAACTTATTGGAATTGCATACAACAGACTGATTCGGATGGATGCCAGCACTGGAGATGCAATTAAAACATGGCGTTTCAGCAACATGAAACAGTGGAATGTCAACTGGGAAATCAAAATGGTCACCGTAGAGTTTGCAGATGAAGTACGATTGTCCTTCATTTGTACTGAAGTAGATTGCAAAGTGGTTCATGAATTCATTGGTGGCTACATATTTCTCTCAACACGTGCAAAAGACCAAAACGAGAGTTTAGATGAAGAGATGTTCTACAAACTTACCAGTGGTTGGGTGTGAATAGGAATACTGTTTAATGAAACTCCACGGCCATAACAATATTTAACTTTAAAAGCTGTTTGTTATATGCTGCTTAATAAAGTAAGCTTGAAATTTATCATTTTATCATGAAAACTTCTTTGCCTTACCAGACCAGTTAATATGTGCACTAAACAAGCACGACTATTAATCTATCATGTTATGATATAATAAACTTGAATTTGTCACACATTCCTTAGGGCCATGAATTGAAAACTGAAATAGTGGGCAAATCAGGAACAAACCATCACTGATTTACTGATTTAAGCTAGCCAAACTGTAAGAAACAAGCCATCTATTTTAAAGCTATCCAGGGCTTAACCTATATGAACTCTATTTATCATGTCTAATGCATGTGATTTAATGTATGTTTAATTTGATATCATGTTTTAAAATATCCTACTTCTGGTAGCCATTTAATTCCTCCCCCTACCCCCAAATAAATCAGGCATGCAGGAGGCCTGATATTTAGTAATGTCATTGTGTTTGACCTTGAAGGAAAATGCTATTAGTCCGTCGTGCTTGATTTGTTTTTGTCCTTGAATAAGCATGTTATGTATATTGTCTCGTGTTTTTATTTTTACACCATATTGTATTACACTTTTAGTATTCACCAGCATAATCACTGTCTGCCTAAAATATGCAACTCTTTGCATTACAATATGAAGTAAAGTTCTATGAAGTATGCATTTTGTGTAACTAATGTAAAAACACAAATTTTATAAAATTGTACAGTTTTTTAAAAACTACTCACAACTAGCAGATGGCTTAAATGTAGCAATCTCTGCGTTAATTAAATGCCTTTAAGAGATATAATTAACGTGCAGTTTTAATATCTACTAAATTAAGAATGACTTCATTATGATCATGATTTGCCACAATGTCCTTAACTCTAATGCCTGGACTGGCCATGTTCTAGTCTGTTGCGCTGTTACAATCTGTATTGGTGCTAGTCAGAAAATTCCTAGCTCACATAGCCCAAAAGGGTGCGAGGGAGAGGTGGATTACCAGTATTGTTCAATAATCCATGGTTCAAAGACTGTATAAATGCATTTTATTTTAAATAAAAGCAAAACTTTTATTTA