Transcript asmbl_23606

Sequence
Transcript Sequence for observation asmbl_23606 of TGE0000435:
CCAGCCATGTTGGCCGGGCGGAGGTCTTCGCTGAGGCCCGGGGCGGGGTGGCGCCACCCCTGATTGCGGTGCCACGGACTGCTCCTGCTGGGCGGAGAGGACAGATTTTGCAAAGCGGAGGCTGCGACGGGTCCTGCAGGGGGACAGTGAGGAAAGGGCCGCCTCGTCTCCGCTCCTGGGGGACCGCAGAAATAAGAATCAAACTCCACAATGACAACCTATTTGGAATTCATTCAACAAAATGAAGAACGAGATGGAGTCCGATTTAGTTGGAATGTTTGGCCATCAAGTCGACTGGAAGCTACAAGAATGGTTGTTCCTGTGGCAGCCCTGTTTACACCACTGAAAGAGAGACCTGACTTACCACCTATTCAATATGAACCTGTTCTGTGTAGTAGGACCACTTGCCGTGCAGTTTTGAATCCTTTATGTCAAGTGGATTATCGAGCAAAACTTTGGGCTTGCAACTTTTGTTACCAAAGGAATCAGTTTCCACCTAGTTATGCTGGTATATCTGAACTGAATCAGCCTGCTGAACTTTTACCTCAGTTTTCTAGCATTGAATATGTAGTTCTGCGTGGTCCTCAGATGCCTTTGATATTCCTCTATGTGGTTGATACTTGCATGGAAGATGAAGATTTACAAGCCCTGAAAGAATCCATGCAGATGTCATTAAGTCTTTTACCACCTACAGCTTTGGTTGGACTTATTACTTTTGGGAGAATGGTTCAGGTTCATGAACTTGGATGTGAAGGCATTTCAAAAAGCTATGTCTTCAGAGGAACAAAAGATTTGTCTGCCAAACAACTGCAGGAAATGCTGGGGCTCTCTAAAGTACCACTTACTCAAGCAACACGTGGTCCTCAGGTACAGCAGCCACCTCCTTCCAACAGATTCTTACAACCAGTACAGAAAATAGACATGAATCTCACAGATCTTCTGGGAGAACTCCAGCGAGACCCTTGGCCTGTACCACAGGGAAAGAGACCTTTGCGTTCCTCTGGGGTGGCACTTTCCATAGCTGTAGGACTGCTGGAGTGTACTTTTCCCAACACTGGTGCTCGTATCATGATGTTCATTGGTGGTCCTGCTACTCAGGGGCCTGGAATGGTGGTTGGAGATGAGTTGAAGACACCTATAAGATCGTGGCATGACATTGACAAAGACAATGCCAAATATGTTAAAAAGGGAACTAAGCATTTTGAAGCATTGGCTAATCGAGCTGCTACAACTGGCCATGTTATTGATATCTATGCGTGTGCATTAGATCAGACAGGTCTCCTGGAGATGAAATGCTGTCCCAACCTTACTGGAGGATACATGGTAATGGGTGATTCTTTCAATACTTCCTTATTCAAACAAACTTTTCAAAGAGTCTTTACCAAAGACATGCATGGACAGTTTAAAATGGGCTTTGGTGGTACGCTAGAAATAAAGACCTCAAGGGAAATAAAGATTTCAGGAGCTATTGGACCCTGTGTGTCACTCAATTCTAAAGGACCCTGTGTGTCTGAAAATGAGATAGGAACAGGTGGCACATGTCAGTGGAAGATATGTGGACTTAGTCCCACTACAACCTTAGCCATATATTTTGAGGTTGTCAATCAGCATAATGCTCCAATTCCTCAAGGAGGGCGTGGTGCAATCCAGTTTGTGACTCAGTATCAGCATTCAAGTGGGCAGAGACGCATCCGAGTGACCACCATTGCTAGGAACTGGGCAGATGCTCAAACTCAAATCCAAAACATTGCTGCATCTTTTGACCAGGAGGCAGCTGCCATTCTTATGGCCCGGCTAGCAATATATAGAGCAGAAACAGAAGAAGGTCCAGATGTGCTTAGGTGGCTGGACAGACAGCTCATTCGACTGTGTCAGAAATTTGGAGAATATCATAAAGATGACCCAAGTTCCTTCAGATTTTCAGAAACTTTCTCCCTTTATCCACAGTTTATGTTTCATTTAAGAAGATCTTCTTTCCTGCAAGTTTTTAACAATAGTCCTGATGAGAGTTCATATTATCGTCACCATTTTATGCGTCAAGATCTGACCCAGTCTCTAATTATGATTCAGCCTATCCTGTATGCGTATTCTTTTAGTGGACCACCAGAGCCGGTTCTTCTTGATAGCAGTAGCATTCTTGCAGATCGTATTCTTCTCATGGACACATTCTTCCAGATTTTGATTTATCATGGTGAGACCATAGCACAGTGGCGGAAGTCAGGATACCAGGATATGCCTGAGTATGAAAATTTCCGCCACCTTCTGCAAGCCCCAGTGGATGATGCACAGGAAATTCTTCACTCCAGATTTCCAATGCCAAGATACATTGACACTGAACATGGAGGCAGCCAGGCCCGTTTCCTCCTTTCAAAAGTCAACCCTTCACAGACTCATAATAATATGTATGCCTGGGGGCAGGAGTCTGGAGCACCTATTCTTACAGATGATGTTAGTTTACAAGTGTTTATGGATCACTTGAAGAAACTTGCTGTGTCCAGTGCTGCTTGAAGTGCTAATAATGTTAAAGACACTTAAGAAGATGAAATAATATTCAAATTTCATTTTTTCCTTTTTCCATTTATCTGTGGAAACCAACAGATATTGCTCTATATTTTTTGTATTAGTATGGTTTGAGACAACATATGGAAAATGTTCACATTTGTAGATTAAGCTGGAATTATAATGAGAGCAATAAGAACAAATTTATTTTGCTTACCACAGTGTTATAGCTGGTTCTAGAAATTTGAAGTCTTTATAACTTAATTATGTTTAATAAAAAATAGAGTCTGCCTCGTACTACAGATGTAACTCATTTGTATATTGCAGACAGACCCAAAGTGGCACTGAATTTTCTTGCTCACCTTTTAAAAACTTGTTCCTTAATTTTAGCCAGAAAGCAAAAAAACAATAGTAATGATAAATGTGAACATTTTTGCTTATTCATTGAATATTTTTCTGTAATTTTCAGCACTTATGTATACACTTTTTCTGTACTTACTAGGTTAAGGCAGATTTATTTTTATGATTTGTTTAGGAATTATTTGATTTTATAATGGTAATTTTCATGATGATAATGTTTTTGGTTATTTGGAAAGATAGTTTAGAGATGAAAGGTTTTTTTGGGTAACAATCCCGCAGCTGACAAAAAATGTGAAATTTCCACAAAATATCCAACTTATGTGACTAAACGCAGTAGTTTTTTTAAAAGGGGAGATAGAAAATAAATGGTTTTGTTGGAGTGCATTTTAGTAAGCCTTTGCAGTAAAATGACGGTTGTAACTACTAAACCAAATTTAGTTTTCACAGCATGGTTTTGTTGTTTTCCCCTTGTTTTTCAGAGGTAAATTTTGCATTATATCCTTCAGTATTTTAACACTATTTTGGCAGTTTACACATTACTTTTTGTTTTTCCTTCCTTTTTGTGAAATGTATTAAGTTGTGGTTCTTATTGAAACAGTATTATATAATGTTTGCTTAATTATATCATGTGATGCTCAGTTCTATTTTGATTTATTCATTAGTATTCACTTTTACCTTTAAAGTTTACTTGTAGCAAATATGTTTACATTGATAAAGCCAGATATGTTTTGACAATGAAATTTACATATCAAGTACTGCAAATAAAAGGTGGTGCTATGATATATGCTTAGGAGGACAGTTTTAATGATTGTACTTGCATGAACACAATCATATGATGGTAAAGCAGAAACTTAAGAAAAAATTGTTTATGTGTTATATTCAATTAGCTTAAATAAGTTGCTTTGTTATATTTTATTTGAATTGAACTACGCTAGGCCTAAATGCCAATAAAATATACTTTTCACTGTT