Transcript asmbl_20150

Sequence
Transcript Sequence for observation asmbl_20150 of TGE0008398:
GTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCCTGCAGTGAATAACGATCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTCGGACTTGTCTCAGGTGTGGCCAGAGGCAAACCAGCACTTTAGTAAAGAGATAGACGATGAAGCAAACAGCTATTTCCAGAGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGGTTTAAAGACTCTACCATAAAGAGAGAACGAGAAGTATTTAATTGTATGCTAAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTGTTTGGTGGGATAATTGAAAAAGGACTGGTCACTTACATGGCACTAGGTCTGGCCCTGCGATATGTTCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATTGAGTATGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGCTCCATCACAACACCCGGAAGTATTGCACTGGCTCAGGCTCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCCCTTGCTGGTCAGGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCACCAGGCCAACTGGAGTCAGCTTTAAGAAAGATGTGCCACCTTCTATTAATACTACAAATATAGATACATTGCTTGTGGCCACAGATCAAACTGAAAGAATTGTAGAGCCCCCAGAAAATATCCAGGAGAAAATTGCATTTATCTTCAACAATCTCTCACAGTCGAATATGACACAAAAGGTTGAAGAACTCAAGGAAACTGTGAAGGAAGAATTTATGCCTTGGGTTTCACAGTACCTGGTTATGAAGAGAGTCAGTATTGAGCCAAACTTTCACAGCTTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAATAAGATGGTTCTAAATGAGACCTACAGAAACATCAAAGTTCTCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTACATACTGACTTGGATGTGAAATCTTTGCTGCTAGAGGCTTACGTTAAAGGACAGCAAGAATTGCTCTATGTAGTACCCTTTGTTGCCAAAGTCTTAGAGTCTAGCATTCGTAGTGTGGTTTTTAGGCCACCCAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGCTACATCAGGAACATGACTTAAAGTTAAACTTGAAGTTTGAGATTGAGGTCCTCTGCAAGAACCTTGCATTAGACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCAAACAGCCAGAAGAACTCCCTCCCATCACAACCACAACAACTTCTACGACACCAGCTACCAGTACCACCTGTACAGCCACGGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCCCTCGCAGGCCTGGCACCACACATTACTCTAAACCCAACAATTCCCTTGTTTCAGGCCCATCCGCAGTTGAAGCAGTGTGTGCGTCAAGCAATTGAACGGGCTGTCCAGGAGTTGGTCCATCCTGTGGTGGATCGATCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCTCGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGCATATCTACAAATCTGAAAAACAGTTTTGCCTCAGCTCTTCGTACTGCATCCCCACAACAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCCTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAATTTGCACGCAATGTGCCTGGCTTCTTGCCTACTAATGATTTAAGTCAGCCCACGGGATTTTTAGCTCAGCCTATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATCCCACCAACATTGGCCATGAACCCTCAAGCTCAGGCTCTGAGAAGTCTTTTGGAGGTTGTAGTTTTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTGCTCCAGAAGGCTGTAGAGGGCTTACTAGATGCCACAAGTGGTGCTGATGCTGATCTGCTGCTGCGCTATAGGGAATGCCACCTCTTGGTCTTAAAAGCTCTTCAAGATGGCCGTGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCACCTAGCTCAGTCAATGGAGAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTGCCCATATTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGAATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATTTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAGAAAGCAGAGTACCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAAAGAAAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAGGTTTTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCAGAGCAGCAGCACAATCCTGCTGCTAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTTCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCAGCATTTAAGTTCTGGAACCACGAGTTTGTACACTGTGCCCCAGAAATTGAAAAGTTATTCCAGTCGGTTGCACAGTGCTGCATGGGACAGAAGCAGGCTCAACAAGTAATGGAAGGGACCGGTGCCAGTTAGATGGAACTTCATCTCTGTTGCCTGGCTGTCCCAAGTTCATAAACTGGCTGAAGAATCATTTCAGCTCTTCCTGACGTTCTCAGCCCTTTGGTTCTCGGGTA