Transcript asmbl_23471

Sequence
Transcript Sequence for observation asmbl_23471 of TGE0057239:
TTCCGGGTCATTGGGAGAGTGCGGGATTCCTGGGCCGAGAGCGGGTGGCTGAGCCGGGACCTCGCGTGATTCTCGGAACCCGAGGAGAAGCGGCGTCCGGGGCTATGGCTGTGACTCTGGACAAAGACGCTTATTATCGGCGAGTGAAGAGACTGTACAGCAATTGGCGGAAAGGAGAAGATGAGTATGCCAACGTTGATGCCATTGTTGTATCAGTGGGTGTTGATGAAGAAATTGTTTATGCCAAATCAACTGCCTTACAGACATGGCTCTTTGGTTATGAACTAACTGATACTATCATGGTCTTTTGTGATGACAAAATCATCTTTATGGCCAGCAAGAAAAAAGTGGAGTTCTTGAAACAGATTGCCAACACTAAGGGCAATGAGAATGCTAATGGAGCCCCTGCCATCACACTGCTAATACGAGAAAAGAATGAAAGTAATAAGAGTAGCTTTGACAAAATGATTGAAGCCATTAAAGAAAGCAAGAATGGCAAGAAGATTGGAGTGTTCAGCAAAGACAAATTCCCTGGAGAGTTCATGAAGAGCTGGAATGACTGCCTCAACAAAGAAGGCTTTGACAAAATAGATATCAGTGCAGTTGTGGCATATACCATCGCTGTAAAGGAGGATGGGGAGCTCAACCTAATGAAGAAAGCAGCCAGCATCACTTCTGAAGTCTTCAACAAATTCTTCAAGGAAAGAGTCATGGAAATAGTTGATGCAGATGAGAAAGTTCGACACAGCAAACTGGCTGAGTCTGTGGAAAAGGCCATTGAAGAGAAAAAATACCTTGCTGGGGCAGACCCTTCTACTGTGGAAATGTGTTACCCTCCTATCATTCAGAGTGGTGGCAACTATAATCTCAAGTTCAGTGTGGTGAGTGACAAGAATCATATGCACTTTGGGGCTATCACTTGTGCCATGGGTATTCGCTTCAAGTCTTACTGCTCCAACCTTGTTCGCACTTTGATGGTTGATCCTTCTCAAGAAGTTCAAGAAAATTATAACTTTTTGCTCCAGCTTCAAGAGGAGCTGCTGAAGGAATTAAGACATGGTGTGAAGATATGTGACGTGTATAACGCTGTCATGGACGTGGTTAAAAAGCAGAAGCCAGAACTGCTGAACAAAATTACCAAAAACCTAGGGTTTGGGATGGGAATTGAATTCCGTGAAGGCTCCCTAGTAATCAATAGCAAAAATCAATACAAACTGAAGAAAGGAATGGTTTTCAGCATCAATTTAGGATTCTCAGACCTGACTAACAAGGAGGGGAAAAAGCCAGAAGAGAAAACCTATGCCCTGTTCATTGGTGACACAGTGCTTGTGGATGAGGATGGCCCAGCTACTGTTCTCACTTCTGTGAAGAAGAAAGTGAAGAATGTGGGGATTTTCCTAAAGAATGAAGATGAGGAAGAAGAGGAGGAGGAGAAAGATGAGGCAGAGGACCTTTTGGGAAGAGGTTCTCGGGCAGCATTACTTACAGAAAGAACAAGAAATGAAATGACTGCAGAAGAGAAGCGAAGAGCACATCAGAAAGAACTAGCGGCTCAACTCAATGAAGAAGCAAAGAGGCGATTGACTGAACAAAAGGGAGAACAGCAGATTCAGAAAGCTCGCAAGTCTAATGTGTCCTATAAAAACCCATCTCTGATGCCTAAGGAACCACATATTCGGGAAATGAAGATCTACATCGATAAGAAATATGAGACTGTAATAATGCCCGTGTTTGGCATTGCAACACCGTTTCACATTGCCACAATCAAGAATATAAGTATGTCCGTGGAAGGAGATTATACTTACTTGCGAATCAACTTTTATTGCCCAGGCAGTGCTCTGGGCAGGAATGAAGGCAACATCTTTCCTAACCCTGAAGCGACTTTTGTCAAGGAAATTACATACCGAGCATCAAATATTAAGGCACCCGGAGAACAGACAGTACCAGCCTTGAACCTTCAGAATGCTTTCCGAATTATTAAAGAAGTACAGAAACGTTATAAAACTCGAGAAGCTGAAGAGAAAGAGAAGGAGGGGATTGTAAAACAAGACTCACTGGTGATCAATCTAAACCGGAGTAATCCGAAACTGAAAGATCTATACATTCGCCCAAATATTGCCCAAAAGAGGATGCAAGGCTCACTGGAGGCCCATGTCAATGGCTTCCGCTTCACATCTGTTCGAGGAGACAAAGTGGATATTTTGTACAATAATATTAAGCATGCTTTGTTCCAGCCCTGTGATGGAGAAATGATTATTGTCTTGCACTTTCACCTCAAGAATGCCATCATGTTTGGGAAGAAGCGGCACACGGATGTGCAGTTCTACACAGAAGTGGGAGAGATAACCACGGACTTGGGGAAACATCAGCATATGCATGACCGAGATGACCTCTATGCTGAGCAGATGGAACGAGAAATGAGGCACAAACTGAAAACAGCCTTTAAAAATTTCATTGAGAAAGTAGAGGCTCTAACTAAGGAGGAACTGGAATTTGAAGTGCCTTTTAGGGACTTGGGATTTAACGGAGCTCCCTATAGGAGTACCTGCCTCCTTCAGCCCACTAGTAGTGCGCTGGTAAATGCTACGGAATGGCCACCTTTTGTGGTGACATTGGATGAGGTAGAGCTGATCCACTTTGAGCGGGTCCAGTTTCACCTGAAGAACTTTGATATGGTAATCGTCTACAAGGACTACAGCAAGAAAGTGACCATGATCAACGCCATTCCTGTAGCCTCTCTTGACCCCATCAAGGAATGGTTGAATTCCTGCGACCTGAAATACACAGAAGGAGTACAGTCCCTCAACTGGACTAAAATCATGAAGACCATTGTTGATGACCCTGAGGGCTTCTTCGAACAAGGTGGCTGGTCTTTCCTGGAGCCTGAGGGTGAGGGGAGTGATGCTGAAGAAGGGGATTCAGAGTCTGAAATTGAAGATGAGACTTTTAATCCTTCAGAAGATGACTATGAAGAGGAAGAGGAGGACAGTGATGAAGATTATTCATCAGAAGCAGAAGAGTCAGACTATTCTAAGGAGTCATTGGGTAGTGAAGAAGAGAGTGGAAAGGATTGGGATGAACTGGAGGAAGAAGCCCGAAAAGCGGACCGAGAAAGTCGTTACGAGGAAGAAGAAGAACAAAGTCGAAGTATGAGCCGGAAGAGGAAGGCATCTGTGCACAGTTCGGGCCGTGGCTCTAACCGTGGTTCCAGACACAGCTCTGCACCCCCCAAGAAAAAGAGGAAGTAACTTCTGAACTTTGGCCCTGAGCTCCATTCTTCCTCCAGCCAACCCCTGAAAATTTTACATGACATAGAAACTGTATTTTTCCTTTCGTTTTCATTTGAAGTTTTGCCATTTGTGTTTATGGGTTTAGGGGGCCATTTGTGTGGACCAATCTACTCGGGGAATTCCAGGCCCACCAGGACACGTGCCAATGGCCCCATTCAGATGGCAAGGGAGGAGGTGTTCTTGAAGACAGGAGGAGGCTCCCGCTGTTAATAAATATTGTTTCATTCTTCTCTCTTCCTGTCACCTTCTGCCAAGACATTGATGGCTTCTGACATCTTATTTGGTGTCTCAAAGCTGTATTTCCAAGACAGTGGTACAAGGTGACCCTTAATTACCCGTATCATGGTTCTTGACCAGCACATTCAATCCTCCAACCTACCCTACTGCCATGACCTTCCGCACATCTCTAAGTTTTATCTTTGCAATACTCAAGGTTCTCGGAAATTTGCTAATGGTTGTGATAAACCATACAGCTTGAGCCAGTGAGGCAGATTGGGCTGGTGCCTTCGTCTGAGTTTTCCTGCTTTCCTGCCTCGTGCAGATTCTGAGGTATATCTGCTGCCTTGGAAGACATAAGAAGCAGTGATACTCCCTGGCTCGGTTATTTTCTCCATACAATGCACACATGGTACAATGATAGAAGGCAAAATTGCCACTGTCTTCTTTTTTTTCTCATATATCTAAGGAAGATATATCAGGTTGTGCCTCATGTACCGCTTCTAGTGAAATGTAGAGGAAGGCTCAAAGGAGTCAACATTTATATCTGGAAGGGACAAGTCATGCCTTGGGCCTAGAATACCCTGATGAGAAAAGAGAAGAGGAAGGGAGGCCATATCTACAACACAGCCTCTCGGCACTGCTGCTCCTTATTTTAACTTTGTCTTGCATTGTCCTGTATTTATCACAGTTTCTGTTGAACAGCTTTTCAAGTATTTGGGGAGTTTATCTTGCCATCCTCCCCTTCTGGTTCTCTGCACCCACCTGTCCCACTGCAGTTCCTTCCGTGCTCTGTGACTTTAAGAGAAGAAGGGGGGAGGGGTCCCGGATTTTATGTTTGTTTGTTTTTTCTCCTTAGCAGTAGGACTTGATATTTTCAATTTTGGAAGAACTAAAAGATGAATAAACTGGGT