Transcript asmbl_23465

Sequence
Transcript Sequence for observation asmbl_23465 of TGE0000421:
CGGCAGAGGAGACTCGGGGGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGCTTCTCTACGCAGAACCCGGGAGTAGGAGACTCAGAATCGAATCTCTTCTCCCTCCCCTTCTTGGGCAGCAAGGCGAACCCCATCCCTACTCACTGGAGCTCAGCTTTGATTTTTAACCTCCCTTCCCCACCCTTCCAGAACACACACATTCCATTCCAAAACTGATTTTATAAAGACATTTTAAACATAATGATGCAACTTGGTGTGCACTACAGCAAATGTACAGGTGTTTTTTTTTTAATTGTTTCCAAAACCGGGACCTGGATTTAAGATGTAATTTTTAAAATTTCTATTTCTATTTTTTCTGCAGCAGTTGGGTTAGAGGAGGAGGAGCCTTTTAGCCTCTCATAAACTGACCTCTCTACTTCCTCGTGTATTTTTAAGATTGATTGATGATGTGGAAAGGGCTTTGCTTGTCTGCTACTGAAAACTTTATCCTTGCGGTTTTTGTGGAAACTGCTTTTGGAAAGAGAAAAGAAATGAACTTTACTGACTTGACATTTTTGCACCTCCCGTTTTTCTAATCTGGGCTATTTTTATTTTTGTTTTTTTACAGTGAGATTTTTTTGATCTTCAGCTACAGTAAGTTATTCCAATTTTTTTTTAACATTTTTCCTGACTTTCCGCTGATTTCCTTTTTATTGTTGTTACTAGTTACTATTACTTATTATTATTATATTAATACTTATGATGGTGATGATGATGATGATAATGACACTGATGATTTTTAACCGGATTAAAATCGAGTTTTTCTGAATGTTTCTAAGAATTTCTCCGGCCTCCTGATTGACTTTGGAGTTTTGCATCTTGGGAGAGAAAGCGAAGGCATTAGTATTTTTAAGTGGTTTGATCACGTAAACCTTTTCTCTCCCAACCCCACCCTTGCCCTCATCCCCTTCCCCACACTGAAAAGAATTTTACTGGCTGTTAAGTCTATGACCTTATTTTTCCTGATCTTTAACTTAACTGTTTTAGAGCATCTCTGGACGTCTGTATTTTTAATTTTTTTTATTTTTGTTTTTTTATTTTTAATCTTTCATTTGTTAAATTTTTAAACTGTGCTGCAATAAAATGTGTGTGGTACTACTTAACACTTATGATCGTGATGGCATTTTCCCTGAAAGCCATCTTCCTCCTGTTTCCCTTGAAATCCCATCCTGCTTTTCCTGTACACTACCCCTCACAAACCACAAGCTGCAGCAACATGGATGCCCAGCCTGGAGCAGCAGCAGCCAGGATGACCTGGAGCCAGGGGGGCCTTCGGAACAGATGCACACCCTTCCTGGGTGATGTTTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAGAAAAAAAAAACCCTGGTTTTTTATTTTTGTATTTTATTATTGTTTACTTCAAACTTTGTTTTACAGCGTCCTCCACAAAACCTCTAGAATGCACTAGATATATTTTTCTTGGAGTCATAATCATGATGCATACCAACACAACACTACTCAAATTATATTTCATTGAGATGCATGTTGCATTGAGGAGTCAACTTGACATAGAGTGGAGACTTTTTCAAAATGGCTTTTACATCCTAATGAAAGTTTGGGAAGTATATCCTCTCTGCCTTTTCATCAGTGCTTTGTGGTCCAGCTGGCACCCTTTCTGAGGTTTGTGTTTTGTGCTAAATGGTTTTGTCCTTAAATAGGAGAGGCTCAAAAACATCAAGATTTCAGGAAAATGGCGACAGCTGCATAATGGAACCCCCCTGCTTCTATTTTGTTCTTTTAATTACTATTTATAGCCCCAGTTACCTTCTGAATTCTGAAGTGTATATACCTCCATGTTCCTGAAAACAAGAAAACTCTTACTTCCTGATATTCCATAGACTGCCTTCCCAGGTGATTGAGAACATAGAGAATGTTACACATTTATTTTACTCTAAATGATCTTTTACCCCTGTTAGCTAATCTTTGTGTTTTCCTCAACTTTATTAATTACAGTGATTGCATTTTTAGCATCCAGTTGTAAGATGAATATATTAAACAGCTACCAGTGTTGGTGATACCTCATCCTTGAAAGGCTTAGTTCATTTGTGTTTTATACTTCAGTTTTTCCAGCATAGCAGAAAATGCCGCTTATAATTTTTGTGCACACAAACCTTGGATTCCCCTGTAAAGTTGCTATTGTTTCATAGCATGCGGCACTGGCCTTTTTTCATCCTACTCATTACAGGCAAAACTCATGTCTTATTTATGAGGATTTTATAGATCATTTTCTGTAACAGGTGACAAAAGCAGAAAAGAATGAAGAGGCTGAAGTATGAACTACCCTTGGAGCCCATATACATGATATAGGCAATTTCTTTTGTATGTTAATTCAGTCAAAAATACTACCCACTTGATGTTTTCTAATCTGATGTGAGCTCATGTTACACAGACTTTTAGTAAGTAACCCGTGACTAGAAAATAAACTGGATGCTTAGGAGAGAGTGTCAGATGTATAAGATGCTAATAAAACCTGTTTAATATTATTGTTAGCTGTAAGTTTTTGGGAAATACTGAACAAATTAGTCCACAATCAAGTGTCTACTTTTCCCTTCACTGTAGGGCCTCTCCCTGCACAGAGCAGTCTGTTTAGCTGTGAACACCACAATCTGCAGATGTTCAAGTCCCTTACATAAAATGGCATAGTATTTATATGTAACCTATGCATATTCTCCTGTATATTTTAAATCATCTCTACATTAAAATACCTGATAAAATGTAAATGGTATGTAAATAGTTGTAACTTTTTTTATTTATATTTTTG