Transcript asmbl_19812

Sequence
Transcript Sequence for observation asmbl_19812 of TGE0057219:
CCGCCCCCCGAAGTAGGGCGTGTGGCGTCACTTCCGGCTTCCTTCAGTCCGCTGGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGGAACCATGGCGTCCCTTTCCCTTGCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGAGCAGAGACAGCTCGTCTGACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAGAGCACCTTGGGACCCAAAGGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCTCTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCAGCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACCTCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAGATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCGCTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATGAATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACAAAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCATATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTGGATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCAAATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCTACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAACGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCTGAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTGGAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTGGTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATTCACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAACAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACTGTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCTGTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCTAAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGACCTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATGAGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAGCGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATCATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACCCCTGTTAAGCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAGCAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTGGAATCTGTTTATCGGTGCCCATTATATCCTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATTTGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAACAATTA