Transcript asmbl_19483

Sequence
Transcript Sequence for observation asmbl_19483 of TGE0057208:
AGGAAGGAGGCGAACTGTGGGCCCCGGCCCCATTCATTGCCGTGGCCGGCGGGCACTGGGGCCCCGTGTTTTCAGAGTCATGGAGGCGCTAATTCCTGTCATAAACAAGCTCCAGGACGTCTTCAACACGGTGGGCGCCGACATCATCCAGCTGCCTCAAATCGTCGTAGTGGGAACGCAGAGCAGCGGAAAGAGCTCAGTGCTAGAAAGCCTGGTGGGGAGGGACCTGCTTCCCAGAGGTACTGGAATTGTCACCCGGAGACCTCTCATTCTGCAACTGGTCCATGTTTCACAAGAAGATAAACGGAAAACAACAGGAGAAGAAAATGGGGTGGAAGCAGAAGAATGGGGTAAATTTCTTCACACCAAAAATAAGCTTTACACGGATTTTGATGAAATTCGACAAGAAATTGAAAATGAAACAGAAAGAATTTCAGGAAATAATAAGGGAGTAAGCCCTGAACCAATTCATCTTAAGATTTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAATGGAACAAAGTATCTTGCTAGGACTCTAAACAGGTTACTGATGCATCACATCAGAGATTGTTTACCAGAGTTGAAAACAAGAATAAATGTTCTAGCTGCTCAGTATCAGTCTCTTCTAAATAGCTACGGTGAACCCGTGGATGATAAAAGTGCTACTTTACTCCAACTTATTACCAAATTTGCCACAGAATATTGTAACACTATTGAAGGAACTGCAAAATATATTGAAACTTCGGAGCTATGCGGTGGTGCTAGAATTTGTTATATTTTCCATGAGACTTTTGGGCGAACCTTAGAATCTGTTGATCCACTTGGTGGCCTTAACACTATTGACATTTTGACTGCCATTAGAAATGCTACTGGTCCTCGTCCTGCTTTATTTGTGCCTGAGGTTTCATTTGAGTTACTGGTGAAGCGGCAAATCAAACGTCTAGAAGAGCCCAGCCTCCGCTGTGTGGAACTGGTTCATGAGGAAATGCAAAGGATCATTCAGCACTGTAGCAATTACAGTACACAGGAATTGTTACGATTTCCTAAACTTCATGATGCCATAGTTGAAGTGGTGACTTGTCTTCTTCGTAAAAGGTTGCCTGTTACAAATGAAATGGTCCATAACTTAGTGGCAATTGAACTGGCTTATATCAACACAAAACATCCAGACTTTGCTGATGCTTGTGGGCTAATGAACAATAATATAGAGGAACAAAGGAGAAACAGGCTAGCCAGAGAATTACCTTCAGCTGTATCACGAGACAAGTCTTCTAAAGTTCCAAGTGCTTTGGCACCTGCCTCCCAGGAGCCCTCCCCCGCTGCTTCTGCTGAGGCTGATGGCAAGGTTGCATCTGGAGGTGGTGGGGTTGGAGATGGTGTTCAAGAACCAACCACAGGCAACTGGAGAGGAATGCTGAAAACTTCAAAAGCTGAAGAGTTATTAGCAGAAGAAAAATCAAAACCCATTCCAATTATGCCAGCCAGTCCACAAAAAGGTCATGCCGTGAACCTGCTAGATGTGCCAGTTCCTGTTGCACGAAAACTATCTGCTCGGGAACAGCGAGATTGTGAGGTTATTGAACGACTCATTAAATCATATTTTCTCATTGTCAGAAAGAATATTCAAGACAGTGTGCCAAAGGCAGTAATGCATTTTTTGGTTAATCATGTGAAAGACACTCTTCAGAGTGAGCTAGTAGGCCAGCTGTATAAATCATCCTTATTGGATGATCTTCTGACAGAATCTGAGGACATGGCACAGCGCAGGAAAGAAGCAGCTGATATGCTAAAGGCATTACAAGGAGCCAGTCAAATTATTGCTGAAATCCGGGAGACTCATCTTTGGTGAAGAGAACTATGTAATACTGAGACTTTGTTGACTCAAAACTTGCTAGTTACTGCCTACCTGAGTAGAATCTTATTTATGAACTCCTGTGTATTGCAATGGTATGAATCTGCTCATGTGGAGACTGGCTATAAACTGAAAAGTGTATTCCAAATTGCAGAACACATCACACATTTAATCCAAATAATAAATGGCTGTTTCTAAAGTTTCCCAGTATATATAAAATACATCAAGTCTGTCTTGTGACAGTTTCATCTGAACTTAACTTAAAAACAACTGTTAATGTTCTAGTTGTGCAAAGCAGTTTGCCTGTGGATAAGATGACCTGTGTAATAATCTTTGTTAGTAGTCTTAAAGCTGCTGCCATAGTCCTCCAAGAAGAAAGCACCAAGACAACATTTCATATGACTATAATGCATGTACTATATAAGCTGATCTGGCTTTGAAAGATGTGAGTTGGCAAGTTCCTCACATAGAGTCATTGTATTCCACCTGTCCTTCAATTTAGTTTTTTCTGAGCTTCTTTGCAGCCTTTGATGTGTTTTTAAGAAAGCTGAATGCACAAGAGGATCTGTGACACTGACATGGCTGTGGTGTGCATACTGTGTAGTTACATAGCCCTTCCAATTCTGGGTCCATTTGCACTAGCAAATTAAAATATGCTTTGATTCATACTTAAACCTGAAAGCAGGAATGCCTACATTAATTCCTACATTAAAAACAGCCATCTACCCTTGATTATCTAGAAAGACTTGGTAATGATGGTCAGTTCCTTTTAGATTTCAGAAAATCAAATGATGACCTAAATTTCCCTTAATTTGCAAATACAGTAGTAATTAAGGTACATCTCTAAAGTGGAGCACTTACACCAGGCTCTAAGATTCACTTTGAGGTGGAACTTAAAACCAGTGTACTGTATGTATGCATTGGTAATAGCTACTTTTGCTTCATAGCTTCATACCAACAAAATATATTTATTAGAATAGTATGAAAGTACTGGAGGAGCTGAAAGAAAAACACCCAAGGCTGGGCGTGGTGGCACACGCCTGTAATCCCAGC