Transcript asmbl_18976

Sequence
Transcript Sequence for observation asmbl_18976 of TGE0000191:
TGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGGCAGGGGGGGGACCCGCCGCGGCTGCTGCCACCGCCGCCACCACCGCCTCTGCTCGTGGCGTGGGAAAGGAGGTGTGAGTCCCGGGCGCGAGCCGGCGGCGGCGCCGCTGCGGGAGGGTCGGCGGTGGGAAGGCGATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCGTTTTGACACTGCCTAGTCGGGACTTGTAACATAGAGTATATAACCTTCATTTTTAAGACTGTAATGTGTACTGGTCAGCTTGCTCAGATAGATCTGTGTTTGTGGGGGCCCTTCCTTCCATTTTTGATTTAGTGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGACTCTTCACTCCAAAAAGAAAAGTGTTTTGTTTTTTAATTCTCTGTTCCTTTTGCAAACAATTTTAATGATGGTGTTAAAGCTGTACACCCCAGGACAGTTTATCCTGTCTGAGGAGTAAGTGTACAATTGATCTTTTTTAATTCAGTACAACCCATAATCATGTAAATGCTCATTTTCTTTAGGACATAAAGAGAGCCCTAGGGTGCTCTGAATCTGTACATGTTCTTGTCATAAAATGCATACTGTTGATACAAACCACTGTGAACATTTTTTATTTGAGAATTTTGTTTCAAAGGGATTGCTTTTTCCTCTCATTGTCTTGTTATGTACAAACTAGTTTTTATAGCTATCAACATTAGGAGTAACTTTCAACCTTGCCAGCATCACTGGTATGATGTATATTTAATTAAAGCACACTTTTCCCCGACCGTATACTTAAAATGACAAAGCCATTCTTTTAAATATTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAATTATGTTTTGACACACCCCTAAGTACAAGGTGGTATGGTTGTATACACATGCTGCCTTCTTGGGGATTCAAAAACAGGTTTTTGATTTTGAATAGCAATTAGTGATATAGTGCTGTTTAAGCTACTAACGATAAAAGGTAATAACATTTTATACAATTTCCATATAGTCTATTCATTAAGTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACATTCTTTATTCTGCGGTGAAGTTGAGGCTTATAAGTTAAAACAAAGGAACTAACTTACTGTCCACCAGTTTATACAGAACTCACAGTACCTATGACTTTTTTAAACTAAGATCTGTTAAAAAAGAAATCTGTTTCAACAGATGACCGTGTACAATACCGTGTGGTGAAAATGAATTCAGACTTATTAAATGATGAACTTGTTAAATCTTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTGAATAGATTTTCCTGAATAAATTGCTCTGGAAACCA