Transcript asmbl_18527

Sequence
Transcript Sequence for observation asmbl_18527 of TGE0000137:
GTCTCACAGGAGGAGGGAGCATCTTGTCACTGGCCCTCAGTTTGTGTCTTCCAATCCGCTTTCTTTCTTTAGGAAGTACCAGGATTCCCGGAACAGAAAATGGAGCCATTGCTTACGCGAATCGTTTGAGGGAAGGGGCGGGAGTTGGGGAGGTGGAGTTCCCTGTTAAAACGGGCCACTTGATTAGCAAAGTGGTAGCTGTTATTTTGGGGGAATTCCCGTCTTGATTGCATTAAGGCGGGTCTCCATCTTTCCAGGCCAGGAGGAATGTGGTGGTGGAGGTGGAGGATTGTGGTATGTGGTCAGGAGTGAGAAGAAATAGTAAGGCCGTCCCGGTGAGGGAGAAATGTAACCTAAAACCTGTCTCTGCTGTTGTTGGATTGGGTCACCCCTGGTCTATGGCATGAAAGTTTTATTGGGAGGAGATCTGCTGCAAGAGTCTGATTGCTTGGGTCAGTGCAACAGGACAGAATCTAGTCGCTGCATACCTCCTTCCCTGTCCTCAATCAGGATCAAGTCTTCCATACCAGGGACCAGGCCAAAACCAGACTGCCACTGCCCCTACTTGGGCCCCACTGTCCCCAGAAAGCAGCTGCTGTGATCATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTCGGGGAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAACATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTAAATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTACTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACAGACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAAAGCCAGACAGCCCTAACAAAGCACCCCACCCACCCCTGACATACCTACTGTCACCCTGCCCCAGTCCTACCCCTTCCTCTCCATGCAAGTGTGGCCAGGGCCCTGGGTATCATGTCCACATGCCCAGCAAGAGCCTTGCCTCCCCTGCCTCCCCTCCTTTTTCCTGTCCACCTATATGACCAATCCCTAATTGCTGTCCTGATGATGAGTCATTCCAATTTACTGGATTTAAAACAAAAAGTTGTTACGGTTTCATGGGGTGGCCCCTCTCTCTCTCACCCTCTGGGTTTCGGGAGGTCGAGTGGGGTATTCTCTTTGTTTGGCAGTGGTTGCTGTCCTCTTGGCATCTGAGTCCTTTCCCTGTCCCCACAAGCCCTTCTACTCCCTGTTTGCCTTTCCTTTGCCACCCTCTCCCTGTTTTACATGGAAATTGCACGGGCCTCTCTGTGTTTGCGTGCATGTGTGCGCCTGTATATACATGTATAGAGAGATATATTTGTGGGGGCCGGGGGGAGCGGGGAGGGGGTGGAGTGAAGCTCAGGGCTTGCAGCCAGGACACTGCCCACTGGAGCCTGTCATCTGCCCCTTCCGTGTTGGTGAGATTAAGGGAAGAAGGTGGGAGGGCATTAGTCAAGCCGGACTGCCCCAGTCTTTGACTGGTTACCCTCCTCTCTGCAGGTAGGTTTTTCTGGATGATAGGACAGATGATGGATTCTTCACCACCATTTTCCTTGTACTCTTCTCTCCACCCTTCTTAGGGCTGGAGGATGGCATTTATCTCTAGATGACTGTTCCCAAGGAGATGCCACTCTGCTCTGCCTTACTGTTGGGAAGGAGAGAGGAACCCACTCACTCTTATCAGCTTAGAGTGTTCAACTGATCCTTCCCCACCATCTTCAGATCTGTTCCTCTGGAGCTTGACTGGGGGGTGGGGATGGCAAGTCCATGGTGTGTGTTAGGGACCCAGGGCATTGGGGGAAGGGAGGCGAAGGCCTGAGGTTTTCCATCTTCATTCTCTTTTGTTATTAGGAGAAGGTGAGGCATGGGCCAATCCCATTCCTGCCTTCCAGTGCCCCACCACCCTTCTGATCTTAGGGGTTGGATGGGTCATCTGTCCTTGGTCAGAATTTTCTCACCCTAGTACTCCTACTGGCCTGACCAGGGCTGACTGGGTATTCTAATGAGGAGCTGGGAAGTGGGGTGACATAGCTGACCTTAGTATCAACCCCCCTCTTCTCCAACTCTTGTTTTCTAGTCCAGGATATGCTAAAGGACGAAGATTTTCTATTGTTTCCAGGCCCTCAGACCATCCTTGCTGTCCCTTCACCCTCCATGCCCCTGCCATCCTCACTCACTTCTCATAAATGGATCTGGGGGTTAGAGTGGAGGAAATAAAATCCTGAAGTGGTTGTCAGTGCTTGTGGGATGCAGTGGTCTTCAGGATTCTCCCCGCATTATTATGTAGTTGTTCAGAAGCTGTTGCTACTGCGTCTCTCTGTCTGCAGGGGGCACTTGTTCCTGAGGTCCTCGCCTGGGTCCTGACTTCTGTAGTTTCTGTGAAGACGTGGCTGTCCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCGAGACAGCTGCCCATAACCTGCTAAGGTCAGGGCCCAGGGCCCCCCACAGCATGGCTGAGGGACCCCTTCCCAGTAGGGCTGTCCCAAGCCCCACTCCATGGGGCCAGGTTTCCTGGCCACTTTTGTTGATAGCAGATGGATCAATATTAGTAACCCCATCCAAGATTGAACTGTGAAAGAGAGGTTCCAGGGGTATCTCCCTCAGTGCCAGTTACTTAGTGATGTGTTACCCAGGATGCAGCAGGTGTGTGCAGGTATCTTGCTCTCTAGGCCTGTGTGTGTGTGTGAGTGTGTGTG