Transcript asmbl_18526

Sequence
Transcript Sequence for observation asmbl_18526 of TGE0000137:
GGGGTGGGGGTACGCCGCACAGCTCCAGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGAAGGAAGGAGGGAGCCGGGGAGTGGGCCAGGGCAGCAGCCGGGCTGAAGTCGGCTTGGGGAGCCAGAGGGAGCGGAGCGGAACCTGCGGGGCAGAGGCGGCGGCCGCAGCGGCGCAGCTGATAGCAGGAACAGGATCAAGTCTTCCATACCAGGGACCAGGCCAAAACCAGACTGCCACTGCCCCTACTTGGGCCCCACTGTCCCCAGAAAGCAGCTGCTGTGATCATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTCGGGGAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAACATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTAAATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTACTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACAGACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAAAGCCAGACAGCCCTAACAAAGCACCCCACCCACCCCTGACATACCTACTGTCACCCTGCCCCAGTCCTACCCCTTCCTCTCCATGCAAGTGTGGCCAGGGCCCTGGGTATCATGTCCACATGCCCAGCAAGAGCCTTGCCTCCCCTGCCTCCCCTCCTTTTTCCTGTCCACCTATATGACCAATCCCTAATTGCTGTCCTGATGATGAGTCATTCCAATTTACTGGATTTAAAACAAAAAGTTGTTACGGTTTCATGGGGTGGCCCCTCTCTCTCTCACCCTCTGGGTTTCGGGAGGTCGAGTGGGGTATTCTCTTTGTTTGGCAGTGGTTGCTGTCCTCTTGGCATCTGAGTCCTTTCCCTGTCCCCACAAGCCCTTCTACTCCCTGTTTGCCTTTCCTTTGCCACCCTCTCCCTGTTTTACATGGAAATTGCACGGGCCTCTCTGTGTTTGCGTGCATGTGTGCGCCTGTATATACATGTATAGAGAGATATATTTGTGGGGGCCGGGGGGAGCGGGGAGGGGGTGGAGTGAAGCTCAGGGCTTGCAGCCAGGACACTGCCCACTGGAGCCTGTCATCTGCCCCTTCCGTGTTGGTGAGATTAAGGGAAGAAGGTGGGAGGGCATTAGTCAAGCCGGACTGCCCCAGTCTTTGACTGGTTACCCTCCTCTCTGCAGGTAGGTTTTTCTGGATGATAGGACAGATGATGGATTCTTCACCACCATTTTCCTTGTACTCTTCTCTCCACCCTTCTTAGGGCTGGAGGATGGCATTTATCTCTAGATGACTGTTCCCAAGGAGATGCCACTCTGCTCTGCCTTACTGTTGGGAAGGAGAGAGGAACCCACTCACTCTTATCAGCTTAGAGTGTTCAACTGATCCTTCCCCACCATCTTCAGATCTGTTCCTCTGGAGCTTGACTGGGGGGTGGGGATGGCAAGTCCATGGTGTGTGTTAGGGACCCAGGGCATTGGGGGAAGGGAGGCGAAGGCCTGAGGTTTTCCATCTTCATTCTCTTTTGTTATTAGGAGAAGGTGAGGCATGGGCCAATCCCATTCCTGCCTTCCAGTGCCCCACCACCCTTCTGATCTTAGGGGTTGGATGGGTCATCTGTCCTTGGTCAGAATTTTCTCACCCTAGTACTCCTACTGGCCTGACCAGGGCTGACTGGGTATTCTAATGAGGAGCTGGGAAGTGGGGTGACATAGCTGACCTTAGTATCAACCCCCCTCTTCTCCAACTCTTGTTTTCTAGTCCAGGATATGCTAAAGGACGAAGATTTTCTATTGTTTCCAGGCCCTCAGACCATCCTTGCTGTCCCTTCACCCTCCATGCCCCTGCCATCCTCACTCACTTCTCATAAATGGATCTGGGGGTTAGAGTGGAGGAAATAAAATCCTGAAGTGGTTGTCAGTGCTTGTGGGATGCAGTGGTCTTCAGGATTCTCCCCGCATTATTATGTAGTTGTTCAGAAGCTGTTGCTACTGCGTCTCTCTGTCTGCAGGGGGCACTTGTTCCTGAGGTCCTCGCCTGGGTCCTGACTTCTGTAGTTTCTGTGAAGACGTGGCTGTCCTGTGGGCTCCTGTGTGTGCTGGCTGCGCCCTGAGCTCCGAGACAGCTGCCCATAACCTGCTAAGGTCAGGGCCCAGGGCCCCCCACAGCATGGCTGAGGGACCCCTTCCCAGTAGGGCTGTCCCAAGCCCCACTCCATGGGGCCAGGTTTCCTGGCCACTTTTGTTGATAGCAGATGGATCAATATTAGTAACCCCATCCAAGATTGAACTGTGAAAGAGAGGTTCCAGGGGTATCTCCCTCAGTGCCAGTTACTTAGTGATGTGTTACCCAGGATGCAGCAGGTGTGTGCAGGTATCTTGCTCTCTAGGCCTGTGTGTGTGTGTGAGTGTGTGTG