Transcript asmbl_15879

Sequence
Transcript Sequence for observation asmbl_15879 of TGE0057174:
CTCCGGAGACGGCGTTGGTTTTGGGGTGTGGGGGGTTGGTGGCACTATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTCGAGGCTCGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCTGGCCCGGCTCCCGCTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTGTGCGGCTGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTGGGGTCGCCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAGGTTCCATTGCCTTCTCTTTCCCCCACAATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAGAGGGGGACAAAATCAATGAAGGTGACCTAATTGCAGAGGTTGAAACTGATAAAGCCACTGTTGGATTTGAGAGCCTGGAGGAGTGTTATATGGCAAAGATACTTGTTGCTGAAGGTACCAGGGATGTTCCCATCGGAGCGATCATCTGTATCACAGTTGGCAAGCCTGAGGATATTGAGGCCTTTAAAAATTATACACTGGATTCCTCAGCAGCACCTACCCCACAAGCGGCCCCAGCACCAACCCCTGCTGCCACTGCTTCGCCACCTACACCTTCTGCTCAGGCTCCTGGTAGCTCATATCCCCCTCACATGCAGGTACTTCTTCCTGCCCTCTCTCCCACCATGACCATGGGCACAGTTCAGAGATGGGAAAAAAAAGTGGGTGAGAAGCTAAGTGAAGGAGACTTACTGGCAGAGATAGAAACTGACAAAGCCACTATAGGTTTTGAAGTACAGGAAGAAGGTTATCTGGCAAAAATCCTGGTCCCTGAAGGCACAAGAGATGTCCCTCTAGGAACCCCACTCTGTATCATTGTAGAAAAAGAGGCAGATATATCAGCATTTGCTGACTATAGGCCAACCGAAGTAACAGATTTAAAACCACAAGTGCCACCACCTACCCCACCCCCGGTGGCCGCTGTTCCTCCAACTCCCCAGCCTTTAGCTCCTACACCTTCAGCACCCTGCCCAGCTACTCCTGCTGGACCAAAGGGAAGGGTGTTTGTTAGCCCTCTTGCAAAGAAGTTGGCAGTAGAGAAAGGGATTGATCTTACACAAGTAAAAGGGACAGGACCAGATGGTAGAATCACCAAGAAGGATATCGACTCTTTTGTGCCTAGTAAAGTTGCTCCTGCTCCGGCAGCTGTTGTGCCTCCCACAGGTCCTGGAATGGCACCAGTTCCTACAGGTGTCTTCACAGATATCCCAATCAGCAACATTCGTCGGGTTATTGCACAGCGATTAATGCAATCAAAGCAAACCATACCTCATTATTACCTTTCTATCGATGTAAATATGGGAGAAGTTTTGTTGGTACGGAAAGAACTTAATAAGATATTAGAAGGGAGAAGCAAAATTTCTGTCAATGACTTCATCATAAAAGCTTCAGCTTTGGCATGTTTAAAAGTTCCCGAAGCAAATTCTTCTTGGATGGACACAGTTATAAGACAAAATCATGTTGTTGATGTCAGTGTTGCGGTCAGTACTCCTGCAGGACTCATCACACCTATTGTGTTTAATGCACATATAAAAGGAGTGGAAACCATTGCTAATGATGTTGTTTCTTTAGCAACCAAAGCAAGAGAGGGTAAACTACAGCCACATGAATTCCAGGGTGGCACTTTTACGATCTCCAATTTAGGAATGTTTGGAATTAAGAATTTCTCTGCTATTATTAACCCACCTCAAGCATGTATTTTGGCAATTGGTGCTTCAGAGGATAAACTGGTCCCTGCAGATAATGAAAAAGGGTTTGATGTGGCTAGCATGATGTCTGTTACACTCAGTTGTGATCACCGGGTGGTGGATGGAGCAGTTGGAGCCCAGTGGCTTGCTGAGTTTAGAAAGTACCTTGAAAAACCTATCACTATGTTGTTGTAACTAACTCAAGAATTTCTAAACTCTCCCAGGTCACACTGATTCATTCTTAACAAGATATTTATATGTTATTAAACAGGTGGTTCTTTTTATTTTAACCAGTTATTTTTATTATTGAGTCTGTCCAGATAAGTTATTTATAATGGGCATTACTGAATTTTTAAAATGCCGATTACACCCAAATATTGTGCACATTTAATAATCAGACACCAGATTTTTAGCTCTGTACTCCTAATTAAGGGACATGTATGTGGCCTTGCCTAGCCCTTTGGTGATAAGTACTTCCTCTAGGAAATGTACGATAGGTAGAATTGTGGTTCCCTAAAGACAAGTACATAAAGGTGACCCTGATGAAACCTTGAAGTTCTGAAATTTAACTGCCTAAAATGTTCTCCTTAGATGTGAGAGAAAGAGAAATCAGAAAAATTAATTCTCTTGGGGGAAGGGCTTGAATTGAAGCTTTACTTTAGAATTTAGCCCTGGTTTGAAATTTTCCATTACATGATCTTGGTTTATCATCGATGGGAAGGGTAGAAAACTTCAAGGAAAATAAGTGAAATTTTAAAAGTCAGCATTTTCTTAGACCTCTTCAGCTGATTGTTTATTTTTCTATGAATTCCTACACATGGTTATTCCCCCCTACTTGAGATAATCTAAATATAAACCAGCTACTTGATGTAACTGAGAATTTGTGTGGATATTTATTTAAACAAATGTGTAATTTTGAGTACAGAATTCAACAGTTACCTCCAAAAAAGAAACATTGTTAATATAATTTAACAGAAGTTGTGAAACTAAAATTTTCTAAGATTAACTGGTAGTTCATTGTAAATGAACATAATGAACAGAATTTATGACTCCACTGTGGAAAATGCTATCAAATAACTAAGGAATATATATGGAATAAGTGTACATATGTAAAATATTGTTACTAGAGTTAGATATGTGCCAAAGTCCATTTATCCCAAATCCTGTCTGAAAAG