Transcript asmbl_15847

Sequence
Transcript Sequence for observation asmbl_15847 of TGE0057004:
GCTAGGGGTGCGGGGTTGGGGAGGAGGCCGCTAGTCTACGCCTGTGGAGCCGATACTCAGCCCTCTGCGACCATGGCTGTGCTGGCGGCACTTCTGCGCAGCGGCGCCCGCAGCCGCAGCCCCCTGCTCCGGAGGCTGGTGCAGGAAATAAGATATGTGGAACGGAGTTATGTATCAAAACCCACTTTGAAGGAAGTGGTCATAGTAAGTGCTACAAGAACACCCATTGGATCTTTTTTAGGCAGCCTTTCCTTGCTGCCAGCCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAAGCTCCTACAAGGCAGGCAGTATTGGGTGCAGGCTTACCTATTTCTACTCCATGTACCACCATAAACAAAGTTTGTGCTTCAGGAATGAAAGCCATCATGATGGCCTCTCAAAGTCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAATGTTCCATATGTAATGAACAGAGGATCAACACCATATGGTGGGGTAAAGCTTGAAGATTTGATTGTAAAAGACGGGCTAACTGATGTCTACAATAAAATTCATATGGGCAGCTGTGCTGAGAATACAGCAAAGAAGCTGAATATTGCACGAAATGAACAGGACGCTTATGCTATTAATTCTTATACCAGAAGTAAAGCAGCATGGGAAGCTGGGAAATTTGGAAATGAAGTTATTCCTGTCACAGTTACAGTAAAAGGTCAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTTAGCAAAGTTCCAAAGCTGAAGACAGTTTTCCAGAAAGAAAATGGCACAGTAACAGCTGCCAATGCCAGTACACTGAATGATGGAGCAGCTGCTCTGGTTCTCATGACGGCAGATGCAGCGAAGAGGCTCAATGTTACACCACTGGCAAGAATAGTAGCATTTGCTGACGCTGCTGTAGAACCTATTGATTTTCCAATTGCTCCTGTATATGCTGCATCTATGGTTCTTAAAGATGTGGGATTGAAAAAAGAAGATATTGCAATGTGGGAAGTAAATGAAGCCTTTAGTCTGGTTGTACTAGCAAACATTAAAATGTTGGAGATTGATCCCCAAAAAGTGAATATCAATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTTGGTCATTTGACTCATGCCTTGAAGCAAGGAGAATACGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCAGAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAGCTTATATTCAGATAAGCTGTTTCATTTTTTATTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAACATTTTGAAATTAAAAATAAATTTCTTCTTCTGCTTTTTTCTTGGTAACCTTGAA